ID: 1201904599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:19076677-19076699 |
| Sequence | TGGGGGTTCTGGGAGCCCGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201904599_1201904611 | 2 | Left | 1201904599 | Y:19076677-19076699 | CCCCCGGGCTCCCAGAACCCCCA | No data | ||
| Right | 1201904611 | Y:19076702-19076724 | CGCTCCCGGAAGCCCCCAGTCGG | No data | ||||
| 1201904599_1201904618 | 20 | Left | 1201904599 | Y:19076677-19076699 | CCCCCGGGCTCCCAGAACCCCCA | No data | ||
| Right | 1201904618 | Y:19076720-19076742 | GTCGGTCCCCCACAGCCCCCTGG | No data | ||||
| 1201904599_1201904619 | 21 | Left | 1201904599 | Y:19076677-19076699 | CCCCCGGGCTCCCAGAACCCCCA | No data | ||
| Right | 1201904619 | Y:19076721-19076743 | TCGGTCCCCCACAGCCCCCTGGG | No data | ||||
| 1201904599_1201904620 | 22 | Left | 1201904599 | Y:19076677-19076699 | CCCCCGGGCTCCCAGAACCCCCA | No data | ||
| Right | 1201904620 | Y:19076722-19076744 | CGGTCCCCCACAGCCCCCTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201904599 | Original CRISPR | TGGGGGTTCTGGGAGCCCGG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||