ID: 1201904601

View in Genome Browser
Species Human (GRCh38)
Location Y:19076679-19076701
Sequence CCTGGGGGTTCTGGGAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201904601_1201904611 0 Left 1201904601 Y:19076679-19076701 CCCGGGCTCCCAGAACCCCCAGG No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904601_1201904618 18 Left 1201904601 Y:19076679-19076701 CCCGGGCTCCCAGAACCCCCAGG No data
Right 1201904618 Y:19076720-19076742 GTCGGTCCCCCACAGCCCCCTGG No data
1201904601_1201904620 20 Left 1201904601 Y:19076679-19076701 CCCGGGCTCCCAGAACCCCCAGG No data
Right 1201904620 Y:19076722-19076744 CGGTCCCCCACAGCCCCCTGGGG No data
1201904601_1201904619 19 Left 1201904601 Y:19076679-19076701 CCCGGGCTCCCAGAACCCCCAGG No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201904601 Original CRISPR CCTGGGGGTTCTGGGAGCCC GGG (reversed) Intergenic
No off target data available for this crispr