ID: 1201904603

View in Genome Browser
Species Human (GRCh38)
Location Y:19076680-19076702
Sequence GCCTGGGGGTTCTGGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201904603_1201904619 18 Left 1201904603 Y:19076680-19076702 CCGGGCTCCCAGAACCCCCAGGC No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904603_1201904618 17 Left 1201904603 Y:19076680-19076702 CCGGGCTCCCAGAACCCCCAGGC No data
Right 1201904618 Y:19076720-19076742 GTCGGTCCCCCACAGCCCCCTGG No data
1201904603_1201904620 19 Left 1201904603 Y:19076680-19076702 CCGGGCTCCCAGAACCCCCAGGC No data
Right 1201904620 Y:19076722-19076744 CGGTCCCCCACAGCCCCCTGGGG No data
1201904603_1201904611 -1 Left 1201904603 Y:19076680-19076702 CCGGGCTCCCAGAACCCCCAGGC No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201904603 Original CRISPR GCCTGGGGGTTCTGGGAGCC CGG (reversed) Intergenic