ID: 1201904604 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:19076687-19076709 |
Sequence | CGGGAGCGCCTGGGGGTTCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1201904604_1201904619 | 11 | Left | 1201904604 | Y:19076687-19076709 | CCCAGAACCCCCAGGCGCTCCCG | No data | ||
Right | 1201904619 | Y:19076721-19076743 | TCGGTCCCCCACAGCCCCCTGGG | No data | ||||
1201904604_1201904620 | 12 | Left | 1201904604 | Y:19076687-19076709 | CCCAGAACCCCCAGGCGCTCCCG | No data | ||
Right | 1201904620 | Y:19076722-19076744 | CGGTCCCCCACAGCCCCCTGGGG | No data | ||||
1201904604_1201904618 | 10 | Left | 1201904604 | Y:19076687-19076709 | CCCAGAACCCCCAGGCGCTCCCG | No data | ||
Right | 1201904618 | Y:19076720-19076742 | GTCGGTCCCCCACAGCCCCCTGG | No data | ||||
1201904604_1201904611 | -8 | Left | 1201904604 | Y:19076687-19076709 | CCCAGAACCCCCAGGCGCTCCCG | No data | ||
Right | 1201904611 | Y:19076702-19076724 | CGCTCCCGGAAGCCCCCAGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1201904604 | Original CRISPR | CGGGAGCGCCTGGGGGTTCT GGG (reversed) | Intergenic | ||