ID: 1201904606

View in Genome Browser
Species Human (GRCh38)
Location Y:19076688-19076710
Sequence CCAGAACCCCCAGGCGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201904590_1201904606 13 Left 1201904590 Y:19076652-19076674 CCCCCTCGGCAGCCCCTCACAGC No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904588_1201904606 20 Left 1201904588 Y:19076645-19076667 CCAGGGCCCCCCTCGGCAGCCCC No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904586_1201904606 25 Left 1201904586 Y:19076640-19076662 CCTGCCCAGGGCCCCCCTCGGCA No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904589_1201904606 14 Left 1201904589 Y:19076651-19076673 CCCCCCTCGGCAGCCCCTCACAG No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904597_1201904606 0 Left 1201904597 Y:19076665-19076687 CCCTCACAGCAGCCCCCGGGCTC No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904592_1201904606 11 Left 1201904592 Y:19076654-19076676 CCCTCGGCAGCCCCTCACAGCAG No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904587_1201904606 21 Left 1201904587 Y:19076644-19076666 CCCAGGGCCCCCCTCGGCAGCCC No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904598_1201904606 -1 Left 1201904598 Y:19076666-19076688 CCTCACAGCAGCCCCCGGGCTCC No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904591_1201904606 12 Left 1201904591 Y:19076653-19076675 CCCCTCGGCAGCCCCTCACAGCA No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904593_1201904606 10 Left 1201904593 Y:19076655-19076677 CCTCGGCAGCCCCTCACAGCAGC No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
1201904596_1201904606 1 Left 1201904596 Y:19076664-19076686 CCCCTCACAGCAGCCCCCGGGCT No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201904606 Original CRISPR CCAGAACCCCCAGGCGCTCC CGG Intergenic
No off target data available for this crispr