ID: 1201904611

View in Genome Browser
Species Human (GRCh38)
Location Y:19076702-19076724
Sequence CGCTCCCGGAAGCCCCCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201904599_1201904611 2 Left 1201904599 Y:19076677-19076699 CCCCCGGGCTCCCAGAACCCCCA No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904590_1201904611 27 Left 1201904590 Y:19076652-19076674 CCCCCTCGGCAGCCCCTCACAGC No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904605_1201904611 -9 Left 1201904605 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904597_1201904611 14 Left 1201904597 Y:19076665-19076687 CCCTCACAGCAGCCCCCGGGCTC No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904589_1201904611 28 Left 1201904589 Y:19076651-19076673 CCCCCCTCGGCAGCCCCTCACAG No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904593_1201904611 24 Left 1201904593 Y:19076655-19076677 CCTCGGCAGCCCCTCACAGCAGC No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904592_1201904611 25 Left 1201904592 Y:19076654-19076676 CCCTCGGCAGCCCCTCACAGCAG No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904598_1201904611 13 Left 1201904598 Y:19076666-19076688 CCTCACAGCAGCCCCCGGGCTCC No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904601_1201904611 0 Left 1201904601 Y:19076679-19076701 CCCGGGCTCCCAGAACCCCCAGG No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904603_1201904611 -1 Left 1201904603 Y:19076680-19076702 CCGGGCTCCCAGAACCCCCAGGC No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904604_1201904611 -8 Left 1201904604 Y:19076687-19076709 CCCAGAACCCCCAGGCGCTCCCG No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904591_1201904611 26 Left 1201904591 Y:19076653-19076675 CCCCTCGGCAGCCCCTCACAGCA No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904600_1201904611 1 Left 1201904600 Y:19076678-19076700 CCCCGGGCTCCCAGAACCCCCAG No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904596_1201904611 15 Left 1201904596 Y:19076664-19076686 CCCCTCACAGCAGCCCCCGGGCT No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201904611 Original CRISPR CGCTCCCGGAAGCCCCCAGT CGG Intergenic
No off target data available for this crispr