ID: 1201904619

View in Genome Browser
Species Human (GRCh38)
Location Y:19076721-19076743
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201904610_1201904619 1 Left 1201904610 Y:19076697-19076719 CCAGGCGCTCCCGGAAGCCCCCA No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904613_1201904619 -9 Left 1201904613 Y:19076707-19076729 CCGGAAGCCCCCAGTCGGTCCCC No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904604_1201904619 11 Left 1201904604 Y:19076687-19076709 CCCAGAACCCCCAGGCGCTCCCG No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904605_1201904619 10 Left 1201904605 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904612_1201904619 -8 Left 1201904612 Y:19076706-19076728 CCCGGAAGCCCCCAGTCGGTCCC No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904607_1201904619 4 Left 1201904607 Y:19076694-19076716 CCCCCAGGCGCTCCCGGAAGCCC No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904609_1201904619 2 Left 1201904609 Y:19076696-19076718 CCCAGGCGCTCCCGGAAGCCCCC No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904603_1201904619 18 Left 1201904603 Y:19076680-19076702 CCGGGCTCCCAGAACCCCCAGGC No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904601_1201904619 19 Left 1201904601 Y:19076679-19076701 CCCGGGCTCCCAGAACCCCCAGG No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904599_1201904619 21 Left 1201904599 Y:19076677-19076699 CCCCCGGGCTCCCAGAACCCCCA No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904600_1201904619 20 Left 1201904600 Y:19076678-19076700 CCCCGGGCTCCCAGAACCCCCAG No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data
1201904608_1201904619 3 Left 1201904608 Y:19076695-19076717 CCCCAGGCGCTCCCGGAAGCCCC No data
Right 1201904619 Y:19076721-19076743 TCGGTCCCCCACAGCCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201904619 Original CRISPR TCGGTCCCCCACAGCCCCCT GGG Intergenic
No off target data available for this crispr