ID: 1201905226

View in Genome Browser
Species Human (GRCh38)
Location Y:19080314-19080336
Sequence TGGCAAAGAGCATTGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201905226_1201905234 23 Left 1201905226 Y:19080314-19080336 CCATCCAGCAATGCTCTTTGCCA No data
Right 1201905234 Y:19080360-19080382 TCCATCCCTCTGGATCCAGCAGG 0: 14
1: 44
2: 107
3: 135
4: 303
1201905226_1201905232 13 Left 1201905226 Y:19080314-19080336 CCATCCAGCAATGCTCTTTGCCA No data
Right 1201905232 Y:19080350-19080372 GCCACTGACTTCCATCCCTCTGG No data
1201905226_1201905236 24 Left 1201905226 Y:19080314-19080336 CCATCCAGCAATGCTCTTTGCCA No data
Right 1201905236 Y:19080361-19080383 CCATCCCTCTGGATCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201905226 Original CRISPR TGGCAAAGAGCATTGCTGGA TGG (reversed) Intergenic
No off target data available for this crispr