ID: 1201905226 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:19080314-19080336 |
| Sequence | TGGCAAAGAGCATTGCTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201905226_1201905234 | 23 | Left | 1201905226 | Y:19080314-19080336 | CCATCCAGCAATGCTCTTTGCCA | No data | ||
| Right | 1201905234 | Y:19080360-19080382 | TCCATCCCTCTGGATCCAGCAGG | 0: 14 1: 44 2: 107 3: 135 4: 303 |
||||
| 1201905226_1201905232 | 13 | Left | 1201905226 | Y:19080314-19080336 | CCATCCAGCAATGCTCTTTGCCA | No data | ||
| Right | 1201905232 | Y:19080350-19080372 | GCCACTGACTTCCATCCCTCTGG | No data | ||||
| 1201905226_1201905236 | 24 | Left | 1201905226 | Y:19080314-19080336 | CCATCCAGCAATGCTCTTTGCCA | No data | ||
| Right | 1201905236 | Y:19080361-19080383 | CCATCCCTCTGGATCCAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201905226 | Original CRISPR | TGGCAAAGAGCATTGCTGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||