ID: 1201908260

View in Genome Browser
Species Human (GRCh38)
Location Y:19106918-19106940
Sequence GCCTGACATCTCTACAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201908257_1201908260 19 Left 1201908257 Y:19106876-19106898 CCACATTTGTTTCATTAAATGAT No data
Right 1201908260 Y:19106918-19106940 GCCTGACATCTCTACAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201908260 Original CRISPR GCCTGACATCTCTACAAGTT AGG Intergenic
No off target data available for this crispr