ID: 1201913356

View in Genome Browser
Species Human (GRCh38)
Location Y:19156233-19156255
Sequence GATCTGCATGAGTTTAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201913356_1201913359 25 Left 1201913356 Y:19156233-19156255 CCTTTTCTAAACTCATGCAGATC No data
Right 1201913359 Y:19156281-19156303 CATTTGCCCATAAGTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201913356 Original CRISPR GATCTGCATGAGTTTAGAAA AGG (reversed) Intergenic
No off target data available for this crispr