ID: 1201913359

View in Genome Browser
Species Human (GRCh38)
Location Y:19156281-19156303
Sequence CATTTGCCCATAAGTTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201913356_1201913359 25 Left 1201913356 Y:19156233-19156255 CCTTTTCTAAACTCATGCAGATC No data
Right 1201913359 Y:19156281-19156303 CATTTGCCCATAAGTTAAAAAGG No data
1201913358_1201913359 -6 Left 1201913358 Y:19156264-19156286 CCAGCATTTATGACTGTCATTTG No data
Right 1201913359 Y:19156281-19156303 CATTTGCCCATAAGTTAAAAAGG No data
1201913357_1201913359 3 Left 1201913357 Y:19156255-19156277 CCACAGACACCAGCATTTATGAC No data
Right 1201913359 Y:19156281-19156303 CATTTGCCCATAAGTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201913359 Original CRISPR CATTTGCCCATAAGTTAAAA AGG Intergenic
No off target data available for this crispr