ID: 1201913876

View in Genome Browser
Species Human (GRCh38)
Location Y:19161507-19161529
Sequence TTATGAACTTTTTAGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201913876_1201913879 10 Left 1201913876 Y:19161507-19161529 CCTACCAACTAAAAAGTTCATAA No data
Right 1201913879 Y:19161540-19161562 TCACAGCTGAATTCTACCAAAGG 0: 34
1: 1777
2: 6485
3: 4149
4: 1753
1201913876_1201913881 26 Left 1201913876 Y:19161507-19161529 CCTACCAACTAAAAAGTTCATAA No data
Right 1201913881 Y:19161556-19161578 CCAAAGGTACAAAGACGAGCTGG 0: 2
1: 84
2: 2654
3: 4576
4: 6972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201913876 Original CRISPR TTATGAACTTTTTAGTTGGT AGG (reversed) Intergenic
No off target data available for this crispr