ID: 1201913879

View in Genome Browser
Species Human (GRCh38)
Location Y:19161540-19161562
Sequence TCACAGCTGAATTCTACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14198
Summary {0: 34, 1: 1777, 2: 6485, 3: 4149, 4: 1753}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201913877_1201913879 6 Left 1201913877 Y:19161511-19161533 CCAACTAAAAAGTTCATAACCAG No data
Right 1201913879 Y:19161540-19161562 TCACAGCTGAATTCTACCAAAGG 0: 34
1: 1777
2: 6485
3: 4149
4: 1753
1201913876_1201913879 10 Left 1201913876 Y:19161507-19161529 CCTACCAACTAAAAAGTTCATAA No data
Right 1201913879 Y:19161540-19161562 TCACAGCTGAATTCTACCAAAGG 0: 34
1: 1777
2: 6485
3: 4149
4: 1753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201913879 Original CRISPR TCACAGCTGAATTCTACCAA AGG Intergenic
Too many off-targets to display for this crispr