ID: 1201913881

View in Genome Browser
Species Human (GRCh38)
Location Y:19161556-19161578
Sequence CCAAAGGTACAAAGACGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14288
Summary {0: 2, 1: 84, 2: 2654, 3: 4576, 4: 6972}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201913876_1201913881 26 Left 1201913876 Y:19161507-19161529 CCTACCAACTAAAAAGTTCATAA No data
Right 1201913881 Y:19161556-19161578 CCAAAGGTACAAAGACGAGCTGG 0: 2
1: 84
2: 2654
3: 4576
4: 6972
1201913877_1201913881 22 Left 1201913877 Y:19161511-19161533 CCAACTAAAAAGTTCATAACCAG No data
Right 1201913881 Y:19161556-19161578 CCAAAGGTACAAAGACGAGCTGG 0: 2
1: 84
2: 2654
3: 4576
4: 6972
1201913878_1201913881 3 Left 1201913878 Y:19161530-19161552 CCAGACAGATTCACAGCTGAATT 0: 419
1: 1369
2: 3656
3: 7997
4: 5045
Right 1201913881 Y:19161556-19161578 CCAAAGGTACAAAGACGAGCTGG 0: 2
1: 84
2: 2654
3: 4576
4: 6972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201913881 Original CRISPR CCAAAGGTACAAAGACGAGC TGG Intergenic
Too many off-targets to display for this crispr