ID: 1201919830

View in Genome Browser
Species Human (GRCh38)
Location Y:19222269-19222291
Sequence CTGGACTTCTTGGGTCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201919824_1201919830 11 Left 1201919824 Y:19222235-19222257 CCTGTTAAGAGGGGGAATTGAGA No data
Right 1201919830 Y:19222269-19222291 CTGGACTTCTTGGGTCAAATAGG No data
1201919819_1201919830 30 Left 1201919819 Y:19222216-19222238 CCAACAGCAGTTGGGATGTCCTG No data
Right 1201919830 Y:19222269-19222291 CTGGACTTCTTGGGTCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201919830 Original CRISPR CTGGACTTCTTGGGTCAAAT AGG Intergenic
No off target data available for this crispr