ID: 1201919830 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:19222269-19222291 |
Sequence | CTGGACTTCTTGGGTCAAAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1201919824_1201919830 | 11 | Left | 1201919824 | Y:19222235-19222257 | CCTGTTAAGAGGGGGAATTGAGA | No data | ||
Right | 1201919830 | Y:19222269-19222291 | CTGGACTTCTTGGGTCAAATAGG | No data | ||||
1201919819_1201919830 | 30 | Left | 1201919819 | Y:19222216-19222238 | CCAACAGCAGTTGGGATGTCCTG | No data | ||
Right | 1201919830 | Y:19222269-19222291 | CTGGACTTCTTGGGTCAAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1201919830 | Original CRISPR | CTGGACTTCTTGGGTCAAAT AGG | Intergenic | ||
No off target data available for this crispr |