ID: 1201920563

View in Genome Browser
Species Human (GRCh38)
Location Y:19229342-19229364
Sequence GTGGTGCTATTGCAGCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201920563_1201920567 2 Left 1201920563 Y:19229342-19229364 CCAGCAAGCTGCAATAGCACCAC No data
Right 1201920567 Y:19229367-19229389 TATTCCAGCCTGGGAAACAAAGG No data
1201920563_1201920565 -7 Left 1201920563 Y:19229342-19229364 CCAGCAAGCTGCAATAGCACCAC No data
Right 1201920565 Y:19229358-19229380 GCACCACTGTATTCCAGCCTGGG 0: 163
1: 6372
2: 62719
3: 152888
4: 214905
1201920563_1201920564 -8 Left 1201920563 Y:19229342-19229364 CCAGCAAGCTGCAATAGCACCAC No data
Right 1201920564 Y:19229357-19229379 AGCACCACTGTATTCCAGCCTGG 0: 13
1: 459
2: 9352
3: 72250
4: 166875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201920563 Original CRISPR GTGGTGCTATTGCAGCTTGC TGG (reversed) Intergenic
No off target data available for this crispr