ID: 1201920564

View in Genome Browser
Species Human (GRCh38)
Location Y:19229357-19229379
Sequence AGCACCACTGTATTCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248949
Summary {0: 13, 1: 459, 2: 9352, 3: 72250, 4: 166875}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201920563_1201920564 -8 Left 1201920563 Y:19229342-19229364 CCAGCAAGCTGCAATAGCACCAC No data
Right 1201920564 Y:19229357-19229379 AGCACCACTGTATTCCAGCCTGG 0: 13
1: 459
2: 9352
3: 72250
4: 166875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201920564 Original CRISPR AGCACCACTGTATTCCAGCC TGG Intergenic
Too many off-targets to display for this crispr