ID: 1201920565

View in Genome Browser
Species Human (GRCh38)
Location Y:19229358-19229380
Sequence GCACCACTGTATTCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 437047
Summary {0: 163, 1: 6372, 2: 62719, 3: 152888, 4: 214905}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201920563_1201920565 -7 Left 1201920563 Y:19229342-19229364 CCAGCAAGCTGCAATAGCACCAC No data
Right 1201920565 Y:19229358-19229380 GCACCACTGTATTCCAGCCTGGG 0: 163
1: 6372
2: 62719
3: 152888
4: 214905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201920565 Original CRISPR GCACCACTGTATTCCAGCCT GGG Intergenic
Too many off-targets to display for this crispr