ID: 1201920567

View in Genome Browser
Species Human (GRCh38)
Location Y:19229367-19229389
Sequence TATTCCAGCCTGGGAAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201920563_1201920567 2 Left 1201920563 Y:19229342-19229364 CCAGCAAGCTGCAATAGCACCAC No data
Right 1201920567 Y:19229367-19229389 TATTCCAGCCTGGGAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201920567 Original CRISPR TATTCCAGCCTGGGAAACAA AGG Intergenic
No off target data available for this crispr