ID: 1201921429

View in Genome Browser
Species Human (GRCh38)
Location Y:19237502-19237524
Sequence CTCTGTCTTATATGAGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201921427_1201921429 1 Left 1201921427 Y:19237478-19237500 CCAGATGAAAACTAAAAGAATTG No data
Right 1201921429 Y:19237502-19237524 CTCTGTCTTATATGAGTGACTGG No data
1201921426_1201921429 30 Left 1201921426 Y:19237449-19237471 CCGACATAGGCAGAGGTATTAAT No data
Right 1201921429 Y:19237502-19237524 CTCTGTCTTATATGAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201921429 Original CRISPR CTCTGTCTTATATGAGTGAC TGG Intergenic
No off target data available for this crispr