ID: 1201922738

View in Genome Browser
Species Human (GRCh38)
Location Y:19252440-19252462
Sequence GTTGCTTATCTAGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201922735_1201922738 6 Left 1201922735 Y:19252411-19252433 CCAGCTTGAGATTAATGCTAATA No data
Right 1201922738 Y:19252440-19252462 GTTGCTTATCTAGGAAAAACAGG No data
1201922733_1201922738 23 Left 1201922733 Y:19252394-19252416 CCCTCAGGTAAGAATATCCAGCT No data
Right 1201922738 Y:19252440-19252462 GTTGCTTATCTAGGAAAAACAGG No data
1201922734_1201922738 22 Left 1201922734 Y:19252395-19252417 CCTCAGGTAAGAATATCCAGCTT No data
Right 1201922738 Y:19252440-19252462 GTTGCTTATCTAGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201922738 Original CRISPR GTTGCTTATCTAGGAAAAAC AGG Intergenic
No off target data available for this crispr