ID: 1201927442

View in Genome Browser
Species Human (GRCh38)
Location Y:19303397-19303419
Sequence ATGAGCTAATGTAATAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201927440_1201927442 2 Left 1201927440 Y:19303372-19303394 CCCTATATGTCTGACTAGCTCAA No data
Right 1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG No data
1201927439_1201927442 5 Left 1201927439 Y:19303369-19303391 CCACCCTATATGTCTGACTAGCT No data
Right 1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG No data
1201927438_1201927442 15 Left 1201927438 Y:19303359-19303381 CCAGCTGAGTCCACCCTATATGT No data
Right 1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG No data
1201927437_1201927442 25 Left 1201927437 Y:19303349-19303371 CCAAAATGATCCAGCTGAGTCCA No data
Right 1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG No data
1201927441_1201927442 1 Left 1201927441 Y:19303373-19303395 CCTATATGTCTGACTAGCTCAAC No data
Right 1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201927442 Original CRISPR ATGAGCTAATGTAATAAATT TGG Intergenic
No off target data available for this crispr