ID: 1201929651

View in Genome Browser
Species Human (GRCh38)
Location Y:19328349-19328371
Sequence GTGCCAGAGGTCCCCCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201929645_1201929651 12 Left 1201929645 Y:19328314-19328336 CCAAATATGATAACATCAACAAG 0: 1
1: 3
2: 18
3: 29
4: 304
Right 1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG 0: 1
1: 0
2: 3
3: 10
4: 101
1201929644_1201929651 16 Left 1201929644 Y:19328310-19328332 CCTACCAAATATGATAACATCAA 0: 1
1: 2
2: 15
3: 29
4: 283
Right 1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG 0: 1
1: 0
2: 3
3: 10
4: 101
1201929643_1201929651 29 Left 1201929643 Y:19328297-19328319 CCATATGTGAAAACCTACCAAAT 0: 1
1: 0
2: 2
3: 16
4: 243
Right 1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG 0: 1
1: 0
2: 3
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201929651 Original CRISPR GTGCCAGAGGTCCCCCACAA GGG Intergenic
900864618 1:5259447-5259469 AGGCCAGAAGTCCCCAACAAAGG + Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
901948786 1:12725001-12725023 GTGACACAGGTCCCCCATTAGGG + Intronic
910900033 1:92110533-92110555 GTTACAGAGGTCCACAACAAGGG - Intronic
913485789 1:119331827-119331849 GTGCTAGAGGTACACCACACTGG - Intergenic
915672031 1:157497735-157497757 TTGCCAGAGGTTCCCCAGATTGG + Intergenic
918242577 1:182633724-182633746 GGGCCAGAAGTCTCCAACAAGGG - Intergenic
918521504 1:185420117-185420139 ATGGAAGAGGTCCTCCACAATGG - Intergenic
920044125 1:203122515-203122537 GTTCCAGGGGTCCCAGACAAGGG - Intronic
922388667 1:225114825-225114847 GTGCCACAAGTCCACCACAGGGG + Intronic
1074146953 10:110725345-110725367 GACCTACAGGTCCCCCACAAGGG - Intronic
1076803150 10:132841839-132841861 GTGCCAGAGGTGCCCTCCACAGG - Intronic
1076847389 10:133076048-133076070 ATGCCAGGGGTCCCCCACTGGGG - Intronic
1077117128 11:890214-890236 GTGCCTACGGTCCCCCACAGAGG + Intronic
1077269737 11:1670192-1670214 GCTCCACAGTTCCCCCACAAAGG + Intergenic
1077384049 11:2260723-2260745 GTGCCAGATGGGCCCCACGATGG + Intergenic
1083426764 11:62592047-62592069 GTGGCAGAGCTCCCCAACCAGGG - Intronic
1087122456 11:94589299-94589321 GTCTCAGAGGTCCCCCAGATTGG + Intronic
1087209489 11:95432231-95432253 GTTCCAGAGGACCCCCAAGAAGG + Intergenic
1089376811 11:118000317-118000339 GTGCCAGAGGTACCCACCAGAGG - Exonic
1090156940 11:124448460-124448482 CTGCCAGAGGTAGCCCACAGGGG - Intergenic
1091847570 12:3669199-3669221 ATGCCAGAGGTCCCACCCCAGGG - Intronic
1092192935 12:6533647-6533669 GGCCCAGAGGCCTCCCACAAAGG - Intergenic
1094838362 12:34332743-34332765 ATGGCAGAGGTCCCCCACCATGG + Intergenic
1094844191 12:34354269-34354291 GTGGCAGAGGTCCCCCCCATGGG - Intergenic
1094844372 12:34354985-34355007 ATGGCAGAGGTCCCTCCCAATGG - Intergenic
1094845513 12:34359702-34359724 GAGGCAGAGGTCCCCCCCCACGG - Intergenic
1094846174 12:34362324-34362346 GAGGCAGAGGTCCCCAACCACGG - Intergenic
1094846528 12:34363822-34363844 GAGGCAGAGGTCCCGCCCAAGGG - Intergenic
1094846578 12:34364011-34364033 GCGGCAGAGGTCACCCCCAACGG - Intergenic
1094847178 12:34366429-34366451 GAGGCAGAGGTCCCCCAACATGG - Intergenic
1094847442 12:34367535-34367557 GAGGCAGAGGTCCCGCACCACGG - Intergenic
1094848519 12:34372040-34372062 GTGGCAGAGGTCCCCCGCCACGG - Intergenic
1094848995 12:34373922-34373944 GAGGCAGAGGTCCCCCGCACGGG - Intergenic
1094849215 12:34374862-34374884 GTGGCAGAAGTTCCCCACCACGG - Intergenic
1094849389 12:34375585-34375607 GTGGCAGAGGTCCCACCCCACGG - Intergenic
1094849847 12:34377467-34377489 GCGGCAGAGGTCCCACACCATGG - Intergenic
1094850169 12:34378789-34378811 ATGGCAGAGGTCCCCCCCATGGG - Intergenic
1094850865 12:34381780-34381802 GTGGCAGAGGTCCCCCCCAAGGG - Intergenic
1094851048 12:34382531-34382553 GAGGCAGAGGTCACCCACCACGG - Intergenic
1094851517 12:34384371-34384393 GAGGCAGAGGTCCCCCTCACGGG - Intergenic
1094852077 12:34386784-34386806 GAGGCAAAGGTCCCCCACCACGG - Intergenic
1094852296 12:34387705-34387727 GCAGCAGAGGTCCCCCACCATGG - Intergenic
1094852470 12:34388435-34388457 GGGGCAGAGGTCCTCCACCACGG - Intergenic
1094852566 12:34388811-34388833 GAGGCAGAGGTCCCCCCCACGGG - Intergenic
1094852697 12:34389361-34389383 ATGGCAGAGGTCCCCCCCAACGG + Intergenic
1094853574 12:34393093-34393115 GCGGCAGAGGTCCCCCCCACGGG + Intergenic
1094853757 12:34393841-34393863 GAGGAAGAGGTCCCCCACAACGG + Intergenic
1094854073 12:34395160-34395182 GAGTCAGAGGTCCCCCACCACGG + Intergenic
1094856442 12:34404992-34405014 GTGGCAGAGGTCCCCCACTATGG + Intergenic
1094856845 12:34406683-34406705 GAGGCAGAGGTCCCACACCACGG + Intergenic
1094870973 12:34599172-34599194 GTGGCAGAGTTCCCCCCCAGGGG + Intergenic
1094871339 12:34600845-34600867 GTGGCAGAGGTTCGCCCCAAGGG + Intergenic
1094872927 12:34607958-34607980 GAGGCAGTTGTCCCCCACAATGG + Intergenic
1095350900 12:41211145-41211167 CTGCCAGAGTTGCCACACAAGGG + Intronic
1100166217 12:91920942-91920964 GTGCCTGAGCTCACCTACAAGGG + Intergenic
1100863239 12:98829626-98829648 GTGTCAGAGGTGCCCAACATAGG - Intronic
1103723570 12:122987170-122987192 GAGCCAGGCGTCCCCCACAGAGG + Intronic
1104790535 12:131479044-131479066 GTGGCAGAGGTTCGCCACAGAGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1115069377 14:29302494-29302516 GTGCTAGATTTTCCCCACAACGG + Intergenic
1119390206 14:74286617-74286639 GGGCCAGAGGCCCCTCAAAACGG - Intronic
1128869645 15:71144034-71144056 CTTCCAGAGCTCCACCACAAGGG - Intronic
1130307967 15:82727307-82727329 GTGCCAGGGGTGCCTGACAATGG + Intergenic
1139588514 16:67919726-67919748 CTGCCAGAGGTCTCCAACCAAGG - Intronic
1141575067 16:84958472-84958494 TAGTCTGAGGTCCCCCACAAGGG + Intergenic
1141787422 16:86211121-86211143 GTGCCAGAGGTGGCCCTGAAAGG - Intergenic
1143671569 17:8399641-8399663 GTCCCAGAGGGCCGCCACAGTGG - Intergenic
1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG + Exonic
1144854843 17:18262023-18262045 GTCCCAGTGGTCCCCCAGACTGG + Intronic
1154112194 18:11579607-11579629 CTAAAAGAGGTCCCCCACAAAGG - Intergenic
1162029652 19:7911900-7911922 CTGGCTGAGGTCCCCCAGAAAGG - Intronic
1162179828 19:8860855-8860877 CTGCCAGAGGTCACCTACATGGG + Intronic
925781127 2:7382700-7382722 CTTCCAGAGGTGCCCCAAAAGGG - Intergenic
927973664 2:27322091-27322113 ATGGCATAGGGCCCCCACAAAGG - Intronic
931617620 2:64176169-64176191 ATGCCAGAGGCCTCCCAAAATGG + Intergenic
932732352 2:74230342-74230364 GAGGCAGGCGTCCCCCACAAGGG - Intronic
934883700 2:98006156-98006178 GTGCCAGAGGTCCACCGCTGTGG - Intergenic
935715054 2:105932231-105932253 GTGGCAGATGTCCCCCCCAGTGG + Intergenic
942643152 2:178082010-178082032 GTGCCTGAAGTCCCCCACAATGG - Intronic
1169903937 20:10581352-10581374 GTGGCAGATGTCTCCCACCAAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1178750767 21:35300776-35300798 GAGCCAGAGGCACCCCACTAAGG + Intronic
951108940 3:18778230-18778252 GTGCCAGTGGCCCCCCACTGAGG - Intergenic
954241665 3:49298658-49298680 GTCACAGGGGTGCCCCACAAAGG + Intronic
963562363 3:146881958-146881980 GTGTCACAGCTCCCCCAAAATGG - Intergenic
963866227 3:150364587-150364609 GTGGAAAAGGTCCCACACAAAGG - Intergenic
985324733 4:188754765-188754787 ATGCCTGAGCCCCCCCACAATGG + Intergenic
988499871 5:31775803-31775825 GTGCCAAAGGTCTCCCACACTGG + Intronic
988589860 5:32539361-32539383 GCACCAGAGGTGCCCCACCAGGG + Intronic
999270550 5:150294259-150294281 GTCCCTGAGGTCTCCCACACAGG + Intergenic
1004459299 6:15820728-15820750 CTCCCAGAGGTGCCCCACATTGG + Intergenic
1005705383 6:28446608-28446630 ATGCCAGAGTTTCCCCAAAATGG - Intergenic
1006376202 6:33672977-33672999 CCGCCAGAGGTCCCCCACGGAGG - Intronic
1006470595 6:34226647-34226669 GTCCCACAGGTCCCCCAGGAAGG - Intergenic
1007837319 6:44683680-44683702 GTGCCAGAGGTCCCAAGAAAGGG - Intergenic
1008147446 6:47908533-47908555 GTTCAAAAGGACCCCCACAATGG - Intronic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1011527099 6:88276888-88276910 GTGCCTAGGGTGCCCCACAATGG + Intergenic
1018733118 6:166668282-166668304 GTGCCAAGGGCCCCACACAAGGG - Intronic
1019532558 7:1511042-1511064 GAGCCGCAGGTTCCCCACAAGGG - Intergenic
1019729656 7:2623004-2623026 TTGCCACAGGTCGCCCGCAATGG - Intergenic
1020051792 7:5086661-5086683 GTACCTGAAGCCCCCCACAAGGG + Intergenic
1023648267 7:42341959-42341981 GGGACAGAGGGCCCCCAAAAGGG + Intergenic
1024154395 7:46605485-46605507 GTTCCAGAGGTCATCCACAGAGG - Intergenic
1029169664 7:98621668-98621690 AGGCCAGAGTTCCCCCACCAAGG - Intronic
1030811321 7:113975630-113975652 GTCACTGAGGGCCCCCACAATGG - Intronic
1032061661 7:128730095-128730117 ATGCCAGGGCTGCCCCACAATGG - Intronic
1040693219 8:49964623-49964645 GTTCCAGAGGTTTCCCACATGGG - Intronic
1041176732 8:55204520-55204542 TTGCCAGATGTCACCCACAAAGG + Intronic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1060423085 9:123483386-123483408 CTGCCAGATGACCCCCACCATGG + Intronic
1062597962 9:137307534-137307556 GTGCCAGGCTTCCCCCAGAATGG - Intronic
1196456489 X:115894983-115895005 GTGCCAGAACTCACCCACCATGG + Intergenic
1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG + Intergenic