ID: 1201929651

View in Genome Browser
Species Human (GRCh38)
Location Y:19328349-19328371
Sequence GTGCCAGAGGTCCCCCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201929644_1201929651 16 Left 1201929644 Y:19328310-19328332 CCTACCAAATATGATAACATCAA 0: 1
1: 2
2: 15
3: 29
4: 283
Right 1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG 0: 1
1: 0
2: 3
3: 10
4: 101
1201929643_1201929651 29 Left 1201929643 Y:19328297-19328319 CCATATGTGAAAACCTACCAAAT 0: 1
1: 0
2: 2
3: 16
4: 243
Right 1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG 0: 1
1: 0
2: 3
3: 10
4: 101
1201929645_1201929651 12 Left 1201929645 Y:19328314-19328336 CCAAATATGATAACATCAACAAG 0: 1
1: 3
2: 18
3: 29
4: 304
Right 1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG 0: 1
1: 0
2: 3
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201929651 Original CRISPR GTGCCAGAGGTCCCCCACAA GGG Intergenic