ID: 1201934937

View in Genome Browser
Species Human (GRCh38)
Location Y:19400002-19400024
Sequence CTCAGAACTAGAGTATTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201934936_1201934937 -9 Left 1201934936 Y:19399988-19400010 CCAACTCGTAAAAGCTCAGAACT No data
Right 1201934937 Y:19400002-19400024 CTCAGAACTAGAGTATTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201934937 Original CRISPR CTCAGAACTAGAGTATTCAC AGG Intergenic
No off target data available for this crispr