ID: 1201935704

View in Genome Browser
Species Human (GRCh38)
Location Y:19408517-19408539
Sequence ATACACATGGGGCATTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201935698_1201935704 0 Left 1201935698 Y:19408494-19408516 CCATGAACACATAGGGTTAAGCA No data
Right 1201935704 Y:19408517-19408539 ATACACATGGGGCATTTCAGGGG No data
1201935694_1201935704 17 Left 1201935694 Y:19408477-19408499 CCAGGCCAGGAAGCATTCCATGA No data
Right 1201935704 Y:19408517-19408539 ATACACATGGGGCATTTCAGGGG No data
1201935695_1201935704 12 Left 1201935695 Y:19408482-19408504 CCAGGAAGCATTCCATGAACACA No data
Right 1201935704 Y:19408517-19408539 ATACACATGGGGCATTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201935704 Original CRISPR ATACACATGGGGCATTTCAG GGG Intergenic
No off target data available for this crispr