ID: 1201948722

View in Genome Browser
Species Human (GRCh38)
Location Y:19540291-19540313
Sequence TTGTTTTTTCAGATGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201948722_1201948724 9 Left 1201948722 Y:19540291-19540313 CCAGACTCCATCTGAAAAAACAA No data
Right 1201948724 Y:19540323-19540345 AAAACCTGAGTGAACAGAACTGG No data
1201948722_1201948725 10 Left 1201948722 Y:19540291-19540313 CCAGACTCCATCTGAAAAAACAA No data
Right 1201948725 Y:19540324-19540346 AAACCTGAGTGAACAGAACTGGG No data
1201948722_1201948728 20 Left 1201948722 Y:19540291-19540313 CCAGACTCCATCTGAAAAAACAA No data
Right 1201948728 Y:19540334-19540356 GAACAGAACTGGGGTGTCTCTGG No data
1201948722_1201948726 11 Left 1201948722 Y:19540291-19540313 CCAGACTCCATCTGAAAAAACAA No data
Right 1201948726 Y:19540325-19540347 AACCTGAGTGAACAGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201948722 Original CRISPR TTGTTTTTTCAGATGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr