ID: 1201950672 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:19559882-19559904 |
| Sequence | TGTCATTTTTAACTACCAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201950672_1201950673 | 2 | Left | 1201950672 | Y:19559882-19559904 | CCATTTGGTAGTTAAAAATGACA | No data | ||
| Right | 1201950673 | Y:19559907-19559929 | ACTTGAAAAAACACATCAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201950672 | Original CRISPR | TGTCATTTTTAACTACCAAA TGG (reversed) | Intergenic | ||