ID: 1201950673

View in Genome Browser
Species Human (GRCh38)
Location Y:19559907-19559929
Sequence ACTTGAAAAAACACATCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201950672_1201950673 2 Left 1201950672 Y:19559882-19559904 CCATTTGGTAGTTAAAAATGACA No data
Right 1201950673 Y:19559907-19559929 ACTTGAAAAAACACATCAAAAGG No data
1201950671_1201950673 16 Left 1201950671 Y:19559868-19559890 CCTGTCTAGTTGGGCCATTTGGT No data
Right 1201950673 Y:19559907-19559929 ACTTGAAAAAACACATCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201950673 Original CRISPR ACTTGAAAAAACACATCAAA AGG Intergenic