ID: 1201961684

View in Genome Browser
Species Human (GRCh38)
Location Y:19687885-19687907
Sequence CTGTGTAAGTAACAAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201961684_1201961687 11 Left 1201961684 Y:19687885-19687907 CCTTCATTTTGTTACTTACACAG No data
Right 1201961687 Y:19687919-19687941 GAGCAGGTTGTTCAGTTTCCAGG 0: 55
1: 33
2: 24
3: 58
4: 203
1201961684_1201961686 -5 Left 1201961684 Y:19687885-19687907 CCTTCATTTTGTTACTTACACAG No data
Right 1201961686 Y:19687903-19687925 CACAGTAATCATTTAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201961684 Original CRISPR CTGTGTAAGTAACAAAATGA AGG (reversed) Intergenic
No off target data available for this crispr