ID: 1201964089

View in Genome Browser
Species Human (GRCh38)
Location Y:19712586-19712608
Sequence GGCAGCCTCAAAAGTATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201964087_1201964089 4 Left 1201964087 Y:19712559-19712581 CCTACTATAAACAAAAGTTAACT 0: 1
1: 0
2: 4
3: 62
4: 473
Right 1201964089 Y:19712586-19712608 GGCAGCCTCAAAAGTATTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201964089 Original CRISPR GGCAGCCTCAAAAGTATTTC AGG Intronic
900882316 1:5391002-5391024 GGCAGCCTCAAATTTAGGTCCGG + Intergenic
901432532 1:9225781-9225803 GGCAGCCTCAAAACAAAATCTGG + Intergenic
901665634 1:10824733-10824755 GGCATCCTAAAAAGAATGTCAGG - Intergenic
905380516 1:37558440-37558462 GGAAGCCACAAAAGAGTTTCTGG - Intronic
907287299 1:53390095-53390117 GGCAGCCTCAAAAGGACTTGAGG + Intergenic
913219740 1:116649774-116649796 TGCAGCCGGAAAAGTATTACAGG - Intronic
915515902 1:156412600-156412622 GGAAGATTCAACAGTATTTCTGG + Intronic
917403278 1:174676087-174676109 TGCAGCCTGAAAAGTAATTTAGG + Intronic
919094934 1:193022136-193022158 GGCAGGCTCTAGAGTATTCCAGG - Intronic
1065304425 10:24355027-24355049 GTCAGCCCCTAAAGTATTTTTGG + Intronic
1069170945 10:65228141-65228163 AGCAGGCTCAAGAGTATTTTAGG - Intergenic
1069641179 10:69956445-69956467 GGCAACCTCATGAGTATTGCAGG - Intronic
1070412581 10:76156506-76156528 GGCAGCCTGCAGAGTATATCAGG - Intronic
1072864004 10:99039130-99039152 GGCAAACTCAAAAGTCTTTAAGG - Intronic
1073676240 10:105650166-105650188 AGCAGCCTCAAAAGAATCACTGG - Intergenic
1073696810 10:105878570-105878592 TGAATCCTCAAATGTATTTCAGG + Intergenic
1073790096 10:106931222-106931244 AACAGCCAAAAAAGTATTTCTGG - Intronic
1075116602 10:119632106-119632128 GGTAGCCCCAAGACTATTTCAGG - Intergenic
1076268697 10:129131743-129131765 GGCTGCCTGTATAGTATTTCTGG - Intergenic
1079526922 11:21401666-21401688 GGCAGACTCATTAGCATTTCTGG + Intronic
1081543917 11:44056263-44056285 GGCTACCTCCACAGTATTTCTGG + Exonic
1083514026 11:63239103-63239125 TTCAGCCTCAATGGTATTTCAGG - Intronic
1088006496 11:104947106-104947128 GGCAGCACCAAGAATATTTCTGG + Exonic
1088010705 11:104997406-104997428 GGCAGCAGCAAGAATATTTCTGG + Exonic
1089866114 11:121633435-121633457 GGCAAAATCAAAAGTATTTGCGG + Exonic
1093246087 12:16738566-16738588 GGCATCGTCAAAATTATTTCAGG + Intergenic
1095090740 12:38101901-38101923 GGAAGCCTCAGAGCTATTTCTGG + Intergenic
1098744900 12:74223590-74223612 AGCAACCTGAAAAGTTTTTCTGG - Intergenic
1100731053 12:97470059-97470081 GGCAGTGGCAAAATTATTTCAGG - Intergenic
1101570675 12:105950838-105950860 TGAAGCCTGAAAAGTATTTGTGG - Intergenic
1102493059 12:113300522-113300544 TGCAGCCTCAACAGTGTTTGAGG + Intronic
1104057733 12:125243599-125243621 GCCAGCCACAAAAGTATATTGGG + Intronic
1108551594 13:51551216-51551238 GGAAGCCACTAAAGTAGTTCAGG - Intergenic
1111691016 13:91563435-91563457 GTCAGCATCAAAAATGTTTCTGG - Intronic
1116798920 14:49422355-49422377 GGCAGTCCCAGAAATATTTCAGG - Intergenic
1117296981 14:54389421-54389443 GGCAGAGACAAAAGTATTGCTGG - Intergenic
1119329821 14:73785761-73785783 GGCAGCCTGAAAACTATCCCAGG - Intronic
1120528051 14:85600662-85600684 TGCAATTTCAAAAGTATTTCAGG + Intronic
1121587518 14:95072638-95072660 TGCAGCCACAAGAGTATTTCAGG + Intergenic
1124201533 15:27682381-27682403 TTCAACCTCAAAAGAATTTCAGG + Intergenic
1125990256 15:44099775-44099797 GGCAGCCACAACACTATCTCTGG + Intronic
1127506410 15:59602089-59602111 GGCAGTTTCAAAAATATTTTGGG + Intronic
1133271253 16:4611842-4611864 GGGAGCCCCACAAGTATTTGAGG + Intronic
1141209750 16:81966462-81966484 GGAAGGGACAAAAGTATTTCAGG + Intergenic
1141363772 16:83423220-83423242 AGTAGCCTCTAAAGTATTTCAGG + Intronic
1144909160 17:18666556-18666578 AGCAGCCGCACACGTATTTCTGG + Intronic
1149285418 17:55158695-55158717 AGCATCCTGAAAAGTGTTTCAGG - Intronic
1152002976 17:77658379-77658401 GCCAGCCTGAAAAGTATGTTAGG + Intergenic
1153182134 18:2446815-2446837 GGAAGCCTAAAAACTAGTTCAGG - Intergenic
1153188770 18:2515367-2515389 GGGAGCCACAAAAGGATTTCAGG + Intergenic
1154978467 18:21482199-21482221 GAACGCCTCAAAAATATTTCTGG - Intronic
1157380845 18:47215208-47215230 GGCAGCCTCCACAGAAGTTCAGG + Intronic
1159467433 18:68802919-68802941 CGCTGTTTCAAAAGTATTTCTGG + Intronic
1164149264 19:22535019-22535041 TCCTGCTTCAAAAGTATTTCTGG - Intergenic
1165990956 19:39813329-39813351 GGAAGCCACAGAAGTATTTTAGG - Intergenic
1167154042 19:47727389-47727411 GCCAGGCCCACAAGTATTTCTGG + Intronic
928671701 2:33609701-33609723 GGCAGTTTCAAAACTGTTTCAGG - Intergenic
928734197 2:34266779-34266801 GCCAGCCTCATAAATATTTTAGG - Intergenic
928807493 2:35177573-35177595 ACCAGCCTCAAAAGGATTTTAGG - Intergenic
932593515 2:73080675-73080697 GACAGCCTCACTAGTCTTTCGGG - Intronic
935506256 2:103907838-103907860 GGCAGCCACAGAAGTATCCCAGG + Intergenic
935697509 2:105782938-105782960 GGCAGCCTCACCTTTATTTCCGG + Intronic
937390013 2:121477399-121477421 GGAAGCTTAAAAAGTATTTGAGG - Intronic
937595531 2:123667287-123667309 TGCAGCCTCAATAGGAGTTCAGG + Intergenic
937632698 2:124121403-124121425 GAAAGCCTCCAAAATATTTCAGG - Intronic
940056400 2:149516980-149517002 TGCAGTCTCAAAATTATTTTTGG - Intergenic
940697447 2:156997342-156997364 GGTAGCTTCACAAGTATTTTTGG + Intergenic
941893651 2:170608035-170608057 GGCAACTTCATAAGCATTTCTGG - Intronic
945855862 2:215068981-215069003 GGCAGCCTACAGAATATTTCTGG - Intronic
1170997451 20:21376850-21376872 AGATGCCTCTAAAGTATTTCAGG - Intronic
1175762359 20:61570310-61570332 ACCAGCCTCACAAGTAATTCTGG - Intronic
1178481520 21:32983229-32983251 GGCAGCTGCAACAGTATGTCTGG + Intergenic
1181133622 22:20749220-20749242 AACAGGCTCAAAAGTGTTTCTGG - Intronic
1183317573 22:37145361-37145383 GGGAGGCTCAAAAGTTTTCCCGG + Intronic
951632959 3:24741153-24741175 GACAGCCTCAGCAGTATTTATGG + Intergenic
951704779 3:25533066-25533088 GGCAGCCTCTAGAGTATTTTTGG - Intronic
952365967 3:32675236-32675258 GTCTGCCTCAGAAGTCTTTCTGG - Intergenic
955615295 3:60800859-60800881 GGGATCCTCTAAGGTATTTCTGG + Intronic
957619867 3:82581634-82581656 GGCTGTCTCAAAATTATTTTGGG + Intergenic
957759877 3:84541112-84541134 GTTAGCCTCAAAAGTAGTTTAGG + Intergenic
969181660 4:5446668-5446690 GGCAGCTCCAGAAGTATTCCAGG + Exonic
970026917 4:11633645-11633667 GGATACCTCAAAAGAATTTCAGG + Intergenic
970064817 4:12081095-12081117 GGGATCCTCTAAGGTATTTCTGG + Intergenic
974196183 4:58578453-58578475 GCCAACCTCACAAGTATTGCAGG + Intergenic
975238019 4:72023585-72023607 GGGAGCCTCAGAAGTCTCTCAGG - Intergenic
990197093 5:53330133-53330155 GGCAGCCTCAAGGGTACATCTGG - Intergenic
992222517 5:74586833-74586855 GTCAGCCTCCAAATTCTTTCTGG + Intergenic
992922813 5:81544431-81544453 GGCACCCTGTAATGTATTTCAGG + Intronic
995896331 5:117015501-117015523 TACAGCCTTAAAAGAATTTCAGG - Intergenic
998220058 5:140270220-140270242 GGCAGCCTGAAAATGATTTGAGG + Intronic
998490812 5:142544836-142544858 GACAGCCTCAAAACTATCCCTGG - Intergenic
1000824447 5:166027235-166027257 GGAAGACTCAAAAGTAACTCTGG + Intergenic
1000977217 5:167778350-167778372 GACAGCAACAAAAGTATTTTAGG + Intronic
1001243107 5:170085138-170085160 GGCAGCATCTAAAATTTTTCTGG - Intergenic
1004091409 6:12506092-12506114 GCCTGCCTCAAATGCATTTCTGG - Intergenic
1004428706 6:15524226-15524248 AGCAGACTCAAATGGATTTCTGG + Intronic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1006889749 6:37416292-37416314 AGCAGCCTCAAATCTATTTTGGG - Intergenic
1010763904 6:79756703-79756725 AGTAGCCTCAAAAGATTTTCTGG - Intergenic
1011305140 6:85917342-85917364 GGGAGCCTTTAAAGTCTTTCTGG + Intergenic
1013286214 6:108684111-108684133 AGCAGCCGCACACGTATTTCTGG - Exonic
1017083170 6:150687942-150687964 GCCAGCCTGAAAAGTATGGCTGG - Intronic
1028674128 7:93439294-93439316 AGCAAACTCAAAATTATTTCAGG - Intronic
1034701781 7:153102847-153102869 GGCAGCCTCCCAAATATTCCCGG - Intergenic
1036529699 8:9572697-9572719 GGCAGCCTCAAAATTATAGAGGG - Intronic
1038193751 8:25347254-25347276 TGCAGCCTCAGAAGTATGTGAGG + Intronic
1039322499 8:36447613-36447635 GGCAGCCTTATATATATTTCTGG - Intergenic
1040639161 8:49311803-49311825 GACACCCTAAAAATTATTTCAGG + Intergenic
1044572289 8:93734023-93734045 GGCCGCCTCAGGAGCATTTCAGG - Exonic
1056746163 9:89305215-89305237 GGCAACCTCAAAAGCCTTACTGG - Intergenic
1057573593 9:96221931-96221953 GGCATCCTCAAAAATGTTTAGGG + Intergenic
1059915392 9:119094042-119094064 GGCAGCCTCACAACCATTGCTGG + Intergenic
1061512479 9:131069532-131069554 GGCAGCATCAAAAACATTCCTGG - Intronic
1190125318 X:47699575-47699597 GTCTGCCTCAGAAGTGTTTCAGG - Intergenic
1190525075 X:51321046-51321068 TGCAGGCCCAACAGTATTTCCGG + Intergenic
1190544516 X:51511715-51511737 TGCAGGCCCAACAGTATTTCTGG - Intergenic
1193369736 X:80680467-80680489 GGCATCCACAAAAGTACTTCAGG - Intronic
1201964089 Y:19712586-19712608 GGCAGCCTCAAAAGTATTTCAGG + Intronic