ID: 1201965579

View in Genome Browser
Species Human (GRCh38)
Location Y:19730507-19730529
Sequence CAATCACCTATAGCCTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201965579 Original CRISPR CAATCACCTATAGCCTCCAT TGG (reversed) Intronic
909588244 1:77315685-77315707 CAGTCACCTGTCGCCTACATAGG - Intronic
910492834 1:87791765-87791787 CAATAAACTATAGACTCCACAGG - Intergenic
916144144 1:161725161-161725183 GAATCAACTATAACCTCCTTAGG - Intronic
917145069 1:171881729-171881751 CAAGCACCTTTGGCCTCCAGTGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
922919300 1:229288085-229288107 CAAACACCTGTAGCTTGCATAGG + Intronic
923182145 1:231529977-231529999 CAATCACCTGAAGCCTTGATTGG + Intronic
924488673 1:244513424-244513446 CACTCACATATACCCTCCAGGGG - Intronic
1064727425 10:18294935-18294957 CTGTCACCTATAACCTTCATTGG - Intronic
1065487824 10:26251932-26251954 CAATCATTTGTAGCCACCATTGG + Intronic
1073287293 10:102396579-102396601 CAATCCCCTGTGGCCTCCTTCGG - Intronic
1074473732 10:113750703-113750725 CAATAACATCTACCCTCCATAGG + Intergenic
1076113301 10:127877613-127877635 TAATCACCTTTACCCACCATTGG + Intergenic
1078627821 11:12973829-12973851 CAATCACCACTTGCCTCCCTTGG + Intergenic
1081350244 11:42043308-42043330 CATTCACCTATAATCACCATAGG - Intergenic
1082910430 11:58367423-58367445 CAGTTACTTATCGCCTCCATTGG + Intergenic
1083354118 11:62052802-62052824 CAATCACATATAGCAGCCTTTGG - Intergenic
1089464364 11:118675081-118675103 CAATCACCTCTAATTTCCATTGG + Intronic
1104180901 12:126379662-126379684 CAGTCACCTGTAGCCCTCATTGG + Intergenic
1109820096 13:67641581-67641603 CCATTACCTATAGCCTCGAGAGG - Intergenic
1114277492 14:21160306-21160328 CAGTCATCTAGAGCCTCAATTGG + Intergenic
1118917641 14:70121308-70121330 CAATCACCTGGCTCCTCCATGGG - Intronic
1120786271 14:88540245-88540267 CAAAGACCAATAGCATCCATAGG - Intronic
1121924798 14:97917676-97917698 AAATCACCAATAGTTTCCATAGG - Intergenic
1131716894 15:95121430-95121452 CAGTCACCTCAAGGCTCCATGGG + Intergenic
1145182134 17:20762445-20762467 TTATCCCCTATAGCCTCCAGAGG + Intergenic
1150117603 17:62567770-62567792 TAATCAAATATAGCCTCAATAGG + Intronic
1154079183 18:11237354-11237376 CAATCACCTATTCACCCCATTGG - Intergenic
1155094946 18:22546572-22546594 CCCTCACCTGTAGCCTCCACTGG - Intergenic
1159358456 18:67368333-67368355 CAATGACCTATAGCATTCAGTGG - Intergenic
1167095855 19:47374859-47374881 CAATCTCCTGTGTCCTCCATCGG + Intronic
925293348 2:2762756-2762778 CAGTCACCTACAGCCTCTCTGGG + Intergenic
929429105 2:41871582-41871604 CAACCACCTACACCCTCCCTTGG - Intergenic
934680289 2:96278711-96278733 CACTCACCTCTCGCCTCCATAGG - Exonic
941687913 2:168466398-168466420 CACTCACCCAGAGCTTCCATAGG - Intronic
943212557 2:184987052-184987074 TTATCACCTATAGCCTTTATAGG - Intergenic
1171453965 20:25256257-25256279 CAATCACCTAAAGACACCTTAGG - Intronic
1173474019 20:43345818-43345840 CAATCAACTATAGGCTCCCTTGG - Intergenic
1173557264 20:43974708-43974730 TACTCATCTATGGCCTCCATGGG - Intronic
1175823604 20:61924769-61924791 CACTCACCCACAGCCTCCAGGGG + Intronic
960793888 3:121463460-121463482 CAATTACCTATAGATTCTATAGG + Intronic
964770955 3:160224636-160224658 CAATCACTTGTAACCTCCTTAGG + Intergenic
967782147 3:193451315-193451337 CCATAGCCTATAGCCTACATTGG + Intronic
973702933 4:53554323-53554345 CAAACACCTATTGACTCCAGTGG - Intronic
979579065 4:122334374-122334396 GAATCACCTAATGCCTCCAGGGG + Exonic
980289699 4:130829617-130829639 TTCTCACCTATAGTCTCCATGGG + Intergenic
985975697 5:3417741-3417763 CTATCTCCTAGAGCCTCCATGGG + Intergenic
987586704 5:19864993-19865015 CAATCACCTAGCTCCTCAATGGG + Intronic
993607514 5:90011675-90011697 CTATCACCTGTAGCCACTATTGG + Intergenic
996643781 5:125791218-125791240 CAACAACCTATTGGCTCCATTGG + Intergenic
1000757863 5:165183868-165183890 CAACCCCCTATCACCTCCATTGG - Intergenic
1005511714 6:26517848-26517870 CCATCACGTCTAGCCTCCTTGGG + Intergenic
1010309063 6:74361421-74361443 AAAACACCTATAGCCTACAAAGG + Intergenic
1022165558 7:27757062-27757084 TAGTCACCTTTAGCCTCCAAAGG - Intronic
1024925818 7:54614317-54614339 CAATCACATGTGGCCTCCGTGGG - Intergenic
1031261420 7:119525448-119525470 CACTCACCTACTGCCTCCACTGG + Intergenic
1034997119 7:155584570-155584592 CCAGCACCTCCAGCCTCCATCGG + Intergenic
1036441349 8:8783732-8783754 GAATCACCTATCGCCTCGGTGGG + Exonic
1036765949 8:11549438-11549460 CCCTCCCCTACAGCCTCCATGGG + Intronic
1040700424 8:50056798-50056820 CAATCCCCAATTGCCTCCATGGG - Intronic
1043918381 8:85951591-85951613 CAAACACATGAAGCCTCCATTGG + Intergenic
1044508661 8:93049731-93049753 CAATCACTCACAGCCTCCCTTGG + Intergenic
1045479358 8:102579920-102579942 CAATCATCTCAAGGCTCCATGGG - Intergenic
1049591312 8:143464297-143464319 TAATCAGCCATGGCCTCCATGGG + Intronic
1052535341 9:29739200-29739222 CAATAGCCTATGGCCTCCACAGG - Intergenic
1054923328 9:70563496-70563518 CAATCATCTGTAGCCTGAATTGG - Intronic
1055371107 9:75600683-75600705 CGATTACCTATTGCCTCCACAGG - Intergenic
1058956859 9:109957201-109957223 CAATCAGATCTAGCCTCCATCGG - Intronic
1058968254 9:110056878-110056900 AAACCATCTATAGCCTCCAAAGG + Intronic
1185961292 X:4548248-4548270 TAATCTCCTTTAGTCTCCATAGG - Intergenic
1188809060 X:34629970-34629992 CAATCTCCTATTGCCTGCAGGGG - Exonic
1195316006 X:103678884-103678906 AAATTACCTATAGCCTTCACAGG + Intronic
1195572817 X:106415470-106415492 CTATCACTTATAGCCACCAGGGG + Intergenic
1199431820 X:147770557-147770579 CAAACCCCTATAGACTCCACTGG + Intergenic
1199477686 X:148263694-148263716 TAATTACCTATAGACTCCACTGG - Intergenic
1200529665 Y:4319214-4319236 CAATCACTCATTGCCTCCCTTGG - Intergenic
1201965579 Y:19730507-19730529 CAATCACCTATAGCCTCCATTGG - Intronic