ID: 1201969072

View in Genome Browser
Species Human (GRCh38)
Location Y:19771621-19771643
Sequence GCATACAGGTGAGCAGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201969072_1201969080 20 Left 1201969072 Y:19771621-19771643 CCTGTACCTGCTCACCTGTATGC No data
Right 1201969080 Y:19771664-19771686 ATGCAGCAGATCCAACTGAGTGG No data
1201969072_1201969075 -4 Left 1201969072 Y:19771621-19771643 CCTGTACCTGCTCACCTGTATGC No data
Right 1201969075 Y:19771640-19771662 ATGCCCCATCCTACATATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201969072 Original CRISPR GCATACAGGTGAGCAGGTAC AGG (reversed) Intergenic
No off target data available for this crispr