ID: 1201975088

View in Genome Browser
Species Human (GRCh38)
Location Y:19840101-19840123
Sequence GAGGGTTGGACAGTGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201975088_1201975096 8 Left 1201975088 Y:19840101-19840123 CCTGCAACCACTGTCCAACCCTC No data
Right 1201975096 Y:19840132-19840154 GATGAACCCTGTACCTCAGTTGG 0: 23
1: 1061
2: 4039
3: 2455
4: 1241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201975088 Original CRISPR GAGGGTTGGACAGTGGTTGC AGG (reversed) Intergenic
No off target data available for this crispr