ID: 1201983608

View in Genome Browser
Species Human (GRCh38)
Location Y:19935906-19935928
Sequence GTACATGTGAATATAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201983606_1201983608 22 Left 1201983606 Y:19935861-19935883 CCAAATACTGCATGTGCTTACTT No data
Right 1201983608 Y:19935906-19935928 GTACATGTGAATATAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201983608 Original CRISPR GTACATGTGAATATAAAGAA AGG Intergenic
No off target data available for this crispr