ID: 1201988465

View in Genome Browser
Species Human (GRCh38)
Location Y:19995451-19995473
Sequence AAGACACAAGATGCCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201988465_1201988470 24 Left 1201988465 Y:19995451-19995473 CCCACCAAGGCATCTTGTGTCTT No data
Right 1201988470 Y:19995498-19995520 CTGAGGTGATAAATGAGCACTGG No data
1201988465_1201988469 7 Left 1201988465 Y:19995451-19995473 CCCACCAAGGCATCTTGTGTCTT No data
Right 1201988469 Y:19995481-19995503 TGGTTGAAAAATCAGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201988465 Original CRISPR AAGACACAAGATGCCTTGGT GGG (reversed) Intergenic
No off target data available for this crispr