ID: 1202015056

View in Genome Browser
Species Human (GRCh38)
Location Y:20396301-20396323
Sequence CAACATCAAAAAATCCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 1, 1: 0, 2: 10, 3: 118, 4: 564}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202015056 Original CRISPR CAACATCAAAAAATCCATAT AGG Intergenic
903313377 1:22478730-22478752 CAACATCTAAAAATGAGTATGGG - Intronic
904552578 1:31331908-31331930 CCTCATAAAAAAATCCATCTCGG - Intronic
905709978 1:40093892-40093914 AAAAAAAAAAAAATCCATATAGG + Intronic
905750959 1:40463598-40463620 AAACATCAAAGAATCTATGTTGG + Exonic
907466062 1:54637885-54637907 CAACACCAAATATTCCAAATAGG + Exonic
909587451 1:77306220-77306242 CAACATAACAAAAGCCATATAGG - Intronic
910039695 1:82834779-82834801 CATCATCAAACAATCCAACTTGG - Intergenic
911898459 1:103469658-103469680 GAACATAAAAATATCAATATAGG - Intergenic
911942629 1:104067511-104067533 TAACATGATAAAACCCATATAGG - Intergenic
912249562 1:107996904-107996926 CAGAATCAGTAAATCCATATGGG + Intergenic
913465443 1:119137161-119137183 CAAAATCAAGAAATTAATATTGG - Intronic
914146371 1:144998702-144998724 CATCTTCAAAGAATCCATACAGG + Intronic
914320982 1:146559624-146559646 AAACAGCAAATAATGCATATGGG - Intergenic
914383981 1:147149569-147149591 CAGCATCAAAAAATATACATAGG + Intergenic
915155181 1:153869823-153869845 CCTCATCAGAAAATCCAAATTGG + Intronic
915241478 1:154525575-154525597 CAACATTTTAAAATCCAAATAGG + Intronic
915258694 1:154658421-154658443 CAACTTCAAAGAATCAATTTTGG + Intergenic
916324736 1:163544440-163544462 TAACTTCAAAAAGTCCTTATTGG + Intergenic
917107312 1:171505538-171505560 CAACAAAAAAAAATTCAAATTGG - Intronic
917309179 1:173660325-173660347 CAACAGCAAAAAACCCAGAAGGG + Intronic
917634410 1:176920735-176920757 CAACATCTAAAATTCCACAGTGG + Intronic
917649867 1:177065705-177065727 CAGCAGCAAAAAATGCAGATTGG + Intronic
919079524 1:192853233-192853255 CAAAATCAAAAAATTAACATTGG + Intergenic
919292900 1:195655708-195655730 CTACACAAAAAAATACATATTGG + Intergenic
919448261 1:197737482-197737504 CAACATTAAACATTCCATCTTGG + Intronic
920446007 1:206017776-206017798 CAACATAAAAAAAATCATCTGGG - Intronic
920550031 1:206852098-206852120 CAACATAATAAAAGCCATATAGG + Intergenic
922522954 1:226273191-226273213 GAACAACAAAAAACCCAAATGGG - Intronic
923392294 1:233524903-233524925 CAAGAAAAAAAAAGCCATATAGG + Intergenic
923657052 1:235926213-235926235 CAAGATTAAAAACTGCATATTGG - Intergenic
924687440 1:246309106-246309128 CACAATTAAAAAATACATATTGG - Intronic
924761147 1:246987892-246987914 CAACAGCAGAGAATCCATATTGG - Exonic
1063083593 10:2791986-2792008 AAACATCAAAAAAACCCTGTGGG + Intergenic
1063573189 10:7235951-7235973 CAACATCAACAGCTCCAGATAGG + Intronic
1065996389 10:31063423-31063445 TAAAATAAAAAAATACATATAGG + Intergenic
1066676700 10:37895455-37895477 AAACATCAAAGAATCCATACAGG + Intergenic
1066700066 10:38118097-38118119 AAACATCAAAGAATTCATACAGG + Exonic
1067122113 10:43482210-43482232 CAACATCAAGAAACACATATAGG + Exonic
1067136862 10:43616902-43616924 GAACATCAGAAAATCCATACTGG + Exonic
1067300470 10:45003582-45003604 CAACACCAGAAGATCCATACTGG + Exonic
1068012877 10:51476588-51476610 CAACAACAAATAATCCACTTAGG - Intronic
1068421010 10:56793150-56793172 CAAAATAAAAAAATCCTTAGAGG + Intergenic
1068465889 10:57390848-57390870 CAACATCAAAAATTCTAGAATGG - Intergenic
1070033037 10:72695497-72695519 CAGCTACAAAAAATCCATAAAGG - Intronic
1070098315 10:73360172-73360194 CCACATCAGGAAATCAATATTGG - Intergenic
1070595174 10:77827853-77827875 CAACACCAAGAAATCTATCTAGG + Intronic
1070683786 10:78467135-78467157 CAACAACAAAAAACCTGTATGGG + Intergenic
1070936294 10:80298724-80298746 CAACATCAAATAATTAACATTGG + Intergenic
1070936300 10:80298892-80298914 CAACATCAGAAAATCCATACTGG + Intergenic
1071127929 10:82357299-82357321 CCACATCTAAAAATCCTCATGGG - Intronic
1071220615 10:83460585-83460607 AAATAACAAAAAATACATATGGG + Intergenic
1071221548 10:83472804-83472826 CAACAACAAAAAATCAAAAATGG + Intergenic
1072309336 10:94139373-94139395 CAACTTCAAAAAAGCCAAGTGGG + Intronic
1072677991 10:97483058-97483080 CCCCATCAAAAAATATATATAGG - Intronic
1074706557 10:116138099-116138121 CACCATTAAAAAATACATACAGG - Intronic
1075756884 10:124819574-124819596 ATACATCAAAAAATCTATGTAGG - Intronic
1075987837 10:126803492-126803514 CTCCATCAATAAACCCATATAGG + Intergenic
1076040385 10:127242634-127242656 CAACAACAAAAAAAACATAATGG - Intronic
1077765839 11:5159450-5159472 CAAAATAATAAAAACCATATAGG - Intronic
1079614407 11:22472947-22472969 CAACAACAAAAAATCTCTCTGGG + Intergenic
1080097432 11:28425745-28425767 CAACAACAAAAAATATATACAGG - Intergenic
1080124136 11:28711514-28711536 GAACTTCAAAAATTCCACATTGG - Intergenic
1080127705 11:28756476-28756498 CAACTTTAAAAAATTCAAATGGG - Intergenic
1080159635 11:29158232-29158254 CAGGATCAAAAAATCCAGTTTGG - Intergenic
1080351565 11:31391203-31391225 GAACATCATAAACGCCATATAGG + Intronic
1080593410 11:33744593-33744615 CAACATTAAAAAAGCCATGGGGG - Intronic
1080938330 11:36885609-36885631 CAACATCAAAAAAATAATAAGGG - Intergenic
1082899802 11:58235075-58235097 GAACATCAAATGATCAATATTGG + Intergenic
1084307100 11:68293144-68293166 CAATATCCACAAATCCATGTTGG + Intergenic
1086513420 11:87585500-87585522 AAACATCAAAAAATAGATGTTGG - Intergenic
1086883800 11:92180317-92180339 CAACAACAAAAAATCAGCATGGG + Intergenic
1087532494 11:99402209-99402231 CAACATAATAAAAGCCACATAGG - Intronic
1087697505 11:101396789-101396811 CAACATACAAAAATCAATAAAGG - Intergenic
1088156040 11:106805012-106805034 CAACAACACAAAGTTCATATTGG - Intronic
1088400298 11:109416215-109416237 CAACATCAAAAATAGCATGTTGG + Intergenic
1089022801 11:115234420-115234442 AAACAACAAATAATCCAGATGGG - Intronic
1090870692 11:130744206-130744228 CAACAAAAAAAAATTCACATGGG + Intergenic
1092116118 12:6008362-6008384 CAACGTCTAAAAATCAATAAAGG + Intronic
1092155971 12:6281689-6281711 CAGCATCAAAACATGCATTTGGG + Intergenic
1092313669 12:7386825-7386847 CAACATGAGAAAGGCCATATAGG + Intronic
1093520051 12:20039129-20039151 AAAAATAAAAAAATTCATATTGG - Intergenic
1093642113 12:21540228-21540250 AAACATGAAGAAATACATATAGG + Intronic
1094743633 12:33317334-33317356 CAACAATAAAAAATCAATACAGG - Intergenic
1096218860 12:49814939-49814961 GAACATCAAACAACCCAAATTGG - Intronic
1096566395 12:52484820-52484842 CAATATAATAAAGTCCATATAGG - Intergenic
1097351962 12:58558437-58558459 AACTATCAAAAAAACCATATAGG - Intronic
1097554989 12:61125560-61125582 GCACATCTAAAAATGCATATAGG - Intergenic
1097651255 12:62299410-62299432 AAACATAAAAGAATTCATATTGG - Intronic
1097673033 12:62563822-62563844 CAACAACAAAAAACCTATGTGGG - Intronic
1097727122 12:63088035-63088057 CAAAAACCAAAAATCCTTATGGG + Intergenic
1098322417 12:69259028-69259050 CACCACCAACAGATCCATATGGG + Exonic
1098326700 12:69311048-69311070 CAAAATCAAGAAATAGATATTGG + Intergenic
1099147803 12:79068826-79068848 CAACATCATGAGATCCATGTGGG + Intronic
1099243191 12:80162811-80162833 CCACAAGAAAAAACCCATATTGG - Intergenic
1099509567 12:83517534-83517556 CATTAAAAAAAAATCCATATTGG + Intergenic
1101133725 12:101717086-101717108 CAACAACAAAAAACACACATTGG + Intronic
1101932221 12:109023933-109023955 GAACATCAAAAAATACTGATTGG - Intronic
1102652610 12:114452873-114452895 CAACAACAAAACATACATACAGG - Intergenic
1102744566 12:115239033-115239055 GAACAACAAAAAATCCTGATGGG - Intergenic
1103494723 12:121352685-121352707 CAACAACAAAAAAACCACTTTGG - Intronic
1105056599 12:133106061-133106083 CGACATCAAAGAATTCACATAGG + Exonic
1106374646 13:29173929-29173951 AAACATCTAAATATTCATATAGG - Intronic
1109228645 13:59727939-59727961 CAACAACAAAAAGTCAAAATGGG + Intronic
1109907903 13:68869790-68869812 TAACTTCAAAATATACATATGGG + Intergenic
1109993648 13:70092341-70092363 CAACATGAACAAAGTCATATAGG - Intronic
1111065445 13:83085527-83085549 CAGCAGAAAAAAATCAATATGGG + Intergenic
1111482798 13:88853848-88853870 CAAAATCAACAAATACAAATCGG + Intergenic
1112285744 13:98102979-98103001 CAACTTCAAAAAAAGCAAATGGG - Intergenic
1112360991 13:98718519-98718541 CAACAACAAAAAAACCAGCTAGG + Intronic
1112528554 13:100178181-100178203 CAACATCGAAATAACCATACAGG - Intronic
1112725828 13:102303090-102303112 CAACATCAAGAAGTCCACTTTGG - Intronic
1112982710 13:105406167-105406189 CTAGATCAAAAAATACTTATTGG - Intergenic
1113065161 13:106365965-106365987 CAATATAAAAAAATATATATTGG - Intergenic
1114311620 14:21472889-21472911 CAGCATCAAAACATTCATCTGGG + Intronic
1114830078 14:26129997-26130019 CAACAACAAAAAAGCCATTCGGG - Intergenic
1115050147 14:29050266-29050288 AAACAACATAAAAACCATATGGG - Intergenic
1115208908 14:30944940-30944962 CAATATCATAAAATACATCTAGG + Intronic
1115683217 14:35765359-35765381 CTACATTTAAAAATCCCTATAGG + Intronic
1116054875 14:39850994-39851016 CATCATCAATAAATTCAAATGGG + Intergenic
1116671534 14:47848316-47848338 AAAGATCAAAAAAGACATATTGG + Intergenic
1117250009 14:53927424-53927446 CAACAACAAAAAAGCAATTTCGG - Intergenic
1117456098 14:55898358-55898380 CAGCATCACAAAATCCAGACAGG - Intergenic
1119809499 14:77504834-77504856 GAACAACTAAATATCCATATGGG - Intergenic
1120380904 14:83778305-83778327 CAATTTCAAAAAATTCCTATAGG + Intergenic
1120584649 14:86296949-86296971 CAATATCAAAATAAGCATATAGG - Intergenic
1121209044 14:92192921-92192943 CTACATGAGAAACTCCATATGGG + Intergenic
1121431381 14:93890788-93890810 CAACTTCAGAAAGTCCATAGTGG + Intergenic
1121651714 14:95563713-95563735 CAACAAAAAAAAATCCCTATTGG + Intergenic
1122185664 14:99992832-99992854 CAACATAATAAAAGCCAGATAGG - Intronic
1122215430 14:100200507-100200529 CAGAATCAACAAATCCATAGAGG - Intergenic
1123502367 15:20900998-20901020 CAACATCAGAGAATACATACTGG - Intergenic
1123502378 15:20901167-20901189 TAACATCAGAGAATCCATACTGG - Intergenic
1123502385 15:20901251-20901273 CAACATCAGAGAATCCATACTGG - Intergenic
1123559617 15:21474682-21474704 CAACATCAGAGAATACATACTGG - Intergenic
1123559628 15:21474851-21474873 TAACATCAGAGAATCCATACTGG - Intergenic
1123559635 15:21474935-21474957 CAACATCAGAGAATCCATACTGG - Intergenic
1123595853 15:21911979-21912001 CAACATCAGAGAATACATACTGG - Intergenic
1123595864 15:21912148-21912170 TAACATCAGATAATCCATACTGG - Intergenic
1123595871 15:21912232-21912254 CAACATCAGAGAATCCATACTGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1126576988 15:50207034-50207056 TAAAATCCAGAAATCCATATGGG + Intronic
1126703710 15:51388480-51388502 CAACAGCAAATAGTCCCTATGGG - Intronic
1130021083 15:80232459-80232481 CAACAACAAAAAATCATTAAAGG - Intergenic
1130884226 15:88079923-88079945 TGACAACAAAAAATCCATATTGG - Intronic
1130958288 15:88642608-88642630 CAACAACAAAAAATCCAGTGTGG - Intronic
1131606159 15:93904952-93904974 CAACAGCAAAGAGTCCATTTTGG + Intergenic
1202967962 15_KI270727v1_random:201842-201864 CAACATCAGAGAATACATACTGG - Intergenic
1202967973 15_KI270727v1_random:202011-202033 TAACATCAGAGAATCCATACTGG - Intergenic
1202967980 15_KI270727v1_random:202095-202117 CAACATCAGAGAATCCATACTGG - Intergenic
1133244078 16:4435329-4435351 CAACAAAATAAAATCAATATTGG + Intronic
1133330455 16:4970110-4970132 CCACATCAAAAGAACCAGATGGG - Intronic
1135175248 16:20222008-20222030 CACCAACAAAACATCCATAATGG - Intergenic
1136518610 16:30782550-30782572 CAACATCAGAGGATCCACATCGG - Exonic
1136644719 16:31602430-31602452 CAACATCAAATAATTCATACTGG - Intergenic
1136644729 16:31602598-31602620 CAGCCTCAGAGAATCCATATTGG - Intergenic
1136660445 16:31754676-31754698 CAGCCTCAGAGAATCCATATTGG + Intronic
1136660455 16:31754844-31754866 CAACATCAAATAATTCATACTGG + Intronic
1136660483 16:31755348-31755370 CAACATCAAAGAATTCATACCGG + Intronic
1136676718 16:31915774-31915796 CAACATCGGAAAATTCATACTGG + Exonic
1136866087 16:33755871-33755893 CCACATGAATAAATCCATAAAGG + Intergenic
1138261956 16:55630222-55630244 CTAACTCAAAAAATCCAGATGGG - Intergenic
1138690534 16:58764178-58764200 CGAAAACAAAAAATCCTTATGGG - Intergenic
1138763777 16:59575547-59575569 CAACAACAAAAAACCCATGTAGG - Intergenic
1138974537 16:62187840-62187862 GAACATCAATCAATACATATGGG - Intergenic
1139423009 16:66860612-66860634 CAACATCACACAAGCCATCTAGG + Intronic
1139508356 16:67411088-67411110 CAACAAAAAAAAAACCATTTAGG + Intronic
1139744190 16:69061141-69061163 CAACAACAAAAAAACCCTGTAGG - Intronic
1140012549 16:71150483-71150505 AAACAGCAAATAATGCATATGGG + Intronic
1140047230 16:71449030-71449052 CAACATCAGAGAATCCATACTGG - Exonic
1140050358 16:71475321-71475343 CAGCATCAAAGAATCCATACTGG - Exonic
1140406605 16:74715590-74715612 CAACATTAAAAAATCATTAATGG - Intronic
1141048695 16:80740957-80740979 CAAGTTTAAAAAATCCAGATGGG - Intronic
1143193960 17:5061138-5061160 CAACATCAGATAATTCATTTGGG + Intergenic
1143529445 17:7493598-7493620 GAACATCATAAAATCCTTTTGGG + Intronic
1144049129 17:11482851-11482873 CATCATCATAAAAACTATATAGG + Intronic
1144491585 17:15717087-15717109 AAACATCAAAGAATTCATATTGG + Exonic
1144594152 17:16552547-16552569 CAGCATCAAAAAATACATACTGG - Exonic
1144601828 17:16622643-16622665 GAACATCAGAAAATCCATAGTGG - Exonic
1144908898 17:18662118-18662140 AAACATCAAAGAATTCATATTGG - Exonic
1147626708 17:41905032-41905054 CAACATCCAAAAATCCAGGTTGG + Intronic
1147763827 17:42819364-42819386 CTACAGGAAAAAATCCATACTGG + Intronic
1148011359 17:44484361-44484383 TAACATCAAAATATCCATTAAGG + Intronic
1148470400 17:47889593-47889615 CAACAAAAAAAAAGCCATTTGGG - Intergenic
1149240819 17:54646910-54646932 AAAAATCATAAAATACATATGGG + Intergenic
1150500381 17:65644896-65644918 CAACATGAAAAAAATCAGATTGG - Intronic
1152849695 17:82625745-82625767 CATCATCAAACACTCCATCTAGG + Intronic
1153703616 18:7722434-7722456 CACCATCATAAAATCCAGATGGG + Intronic
1154407240 18:14104837-14104859 CAACATTAGAAAATCAATACTGG - Exonic
1154407253 18:14105005-14105027 CAACATCAGAGAATTCATACTGG - Exonic
1154407259 18:14105089-14105111 CAACATCAGAGAGTCCATACTGG - Exonic
1154407266 18:14105173-14105195 CGACATCAAAGAATCCATACTGG - Exonic
1154407274 18:14105257-14105279 CAACATCAGAGAATCCATACTGG - Exonic
1154407287 18:14105425-14105447 CAACACCAGAGAATCCATACCGG - Exonic
1154407296 18:14105509-14105531 CAACATCAGAGAATCCATACTGG - Exonic
1154407303 18:14105593-14105615 CAACATCAGAGAATCCATACTGG - Exonic
1154407317 18:14105842-14105864 CAACATCAAAGAATTTATATTGG - Exonic
1155309171 18:24507417-24507439 CAACATCAAAGAACCCATATTGG - Intergenic
1156210259 18:34932207-34932229 GAACATCATATAATCCATAAGGG - Intergenic
1156240130 18:35245609-35245631 CAACATCAGAGAATCCATACTGG + Exonic
1156246660 18:35306418-35306440 ATACATCAGAGAATCCATATAGG + Intergenic
1156246667 18:35306502-35306524 AAACATCAGAGAATCCATACTGG + Intergenic
1156246671 18:35306582-35306604 AAACATCAAAGAATCCACACTGG + Intergenic
1156252746 18:35366617-35366639 CAAAAACAAACAAACCATATAGG + Intergenic
1156254080 18:35378305-35378327 CAATAACAAAAAATCCCTTTTGG + Intergenic
1156879509 18:42060074-42060096 CAACATTAAAAAATAAATGTTGG - Intronic
1157371372 18:47115359-47115381 CAACAACAAAAAAAACAAATTGG + Intronic
1157886739 18:51375142-51375164 CAACATTATAAAAACCATATAGG + Intergenic
1157984968 18:52426847-52426869 TAATAACAAAAAATCCATTTTGG + Intronic
1158469831 18:57726243-57726265 CAACAACAAAAAAACCACTTGGG + Intronic
1158820396 18:61152275-61152297 CAACTCCAAAAGATCCATATGGG - Intergenic
1160189342 18:76702772-76702794 AAACATCAAAAAACCCATTGAGG + Intergenic
1160369898 18:78363378-78363400 CAACAACAACAAATCCATCGCGG + Intergenic
1160626224 18:80208817-80208839 CCCCATCAAAAAGTCCACATTGG + Intronic
1161365844 19:3879187-3879209 CAATAGCAAGAAATACATATAGG + Intergenic
1161924520 19:7291069-7291091 CAAAAAAAAAAAAGCCATATTGG + Intronic
1162222912 19:9194001-9194023 CAAAAACAAAAAACCCACATGGG - Intergenic
1162239917 19:9342811-9342833 CAACATAAAAGAATACATACAGG + Exonic
1162247465 19:9414050-9414072 CAACATATGAAAATCCATGTGGG - Exonic
1162354656 19:10174730-10174752 CAACAACAAAAAAAACAAATTGG + Intronic
1162875049 19:13615092-13615114 AAACATCAATAAATGGATATAGG + Intronic
1163306440 19:16482582-16482604 CTGTATCAAAAAAACCATATGGG + Intronic
1163614645 19:18319574-18319596 CAACAACAAAAAACCCAAATAGG + Intronic
1163971925 19:20806672-20806694 AAACATAAAATAATCCATACTGG + Exonic
1163989979 19:20989133-20989155 CAACATCAACAAAAACATAAAGG + Intergenic
1164012775 19:21221649-21221671 AAACATAAGAAAATTCATATTGG - Intronic
1164029269 19:21386634-21386656 AAACATAAGAAAATTCATATTGG + Intergenic
1164045611 19:21537209-21537231 CGACATAAAAAAATTCATACTGG + Exonic
1164045646 19:21537629-21537651 CAACATAAGAAAATTCATACTGG + Exonic
1164045652 19:21537713-21537735 CAACATAAGAAAATTCATACTGG + Exonic
1164067162 19:21726620-21726642 AAACATAAAAAAATTCATACTGG - Exonic
1164074987 19:21807128-21807150 CAACATCAGAAAATTTATATTGG - Intronic
1164104067 19:22089176-22089198 CAACATAAAATAATTCATACTGG + Exonic
1164133839 19:22392618-22392640 CAACATAAAAGAATTCATAGTGG - Exonic
1164164970 19:22664141-22664163 CAACATAAAAGAATTCATAGTGG + Exonic
1164174342 19:22756302-22756324 CAACATAAAACAATTCATACTGG - Intronic
1164215776 19:23145612-23145634 CAACATAAAAAAATTCATACTGG + Exonic
1164269013 19:23653254-23653276 AAACATAAAAAAATACATACTGG - Exonic
1164278341 19:23744885-23744907 AAACATAAAAGAATTCATATTGG - Exonic
1165251694 19:34542715-34542737 CAACATCACAGAATTCATACTGG - Intergenic
1165251714 19:34543062-34543084 CACCATCAGAAAATCCATACTGG - Intergenic
1165268700 19:34685025-34685047 CACCATCAGAAAAGCCATACTGG + Exonic
1165274969 19:34741477-34741499 CACCATCAGAAAATCCATACTGG + Exonic
1165274991 19:34741813-34741835 CAACATCACAGAATTCATACTGG + Exonic
1165278828 19:34779648-34779670 CAGCATCAGCAAATCCACATTGG - Intergenic
1165298051 19:34944551-34944573 CAGCATCAAAGAATTCATACTGG + Exonic
1165483516 19:36080926-36080948 CAAAATAAAAAAACCCAAATTGG - Intronic
1165500163 19:36182722-36182744 CAACATCAAAGAATTCATACAGG - Exonic
1165500237 19:36183394-36183416 CAACATCAGAAAATTCACACTGG - Exonic
1165506747 19:36236873-36236895 GAGCATGAGAAAATCCATATTGG + Exonic
1165530267 19:36393591-36393613 GTACATCAGAAAATGCATATTGG - Exonic
1165536291 19:36449230-36449252 AAACATCAAAGAATCCATACAGG - Exonic
1165536299 19:36449314-36449336 CAACATCAGAGAATTCATACTGG - Exonic
1165536322 19:36449566-36449588 CATCATCAGAAAATTCATACTGG - Exonic
1165543649 19:36514676-36514698 AAACATCAGAACATCCATACTGG - Exonic
1165546984 19:36547137-36547159 CAACATCAAAGAATTCATAGTGG - Exonic
1165556657 19:36638867-36638889 CAACATCAAAGAATTCATACTGG - Exonic
1165565168 19:36719868-36719890 CTACATCAGAGAATCCATACAGG + Exonic
1165567933 19:36747942-36747964 CAACATAAACGAATCCATACTGG - Exonic
1165567962 19:36748278-36748300 CAACATCAACGAATCCATACTGG - Exonic
1165568029 19:36749118-36749140 CAACATCAACAAATCCATACTGG - Exonic
1165568137 19:36750462-36750484 CAACAGCAAGAAACCCATACTGG - Exonic
1165576011 19:36818923-36818945 CGACATCAGAAAATTCATACTGG - Exonic
1165582316 19:36877653-36877675 CGACATCAAAGAATTCATACTGG + Exonic
1165582329 19:36877821-36877843 CAGCATCAAAGAATGCATACTGG + Exonic
1165582337 19:36877905-36877927 CAACATCACAGAATTCATACTGG + Exonic
1165583589 19:36892252-36892274 CAACATCAGAGAATTCATTTTGG - Exonic
1165594056 19:36997009-36997031 CGACATCAAAGAATCCATACGGG + Intronic
1165594072 19:36997177-36997199 CTACATCAAAGAATTCATACTGG + Intronic
1165594131 19:36997681-36997703 CAACATCAAAGAATTCATTCAGG + Intronic
1165608362 19:37127457-37127479 CAACATCAAAGTATTCATACTGG + Exonic
1165608384 19:37127709-37127731 CGACATCAAAAAGTTCATACTGG + Exonic
1165608401 19:37127961-37127983 CAACATCAGAAAATTCATAATGG + Exonic
1165608454 19:37128465-37128487 CAACATCAGAGAATCCATACTGG + Exonic
1165608468 19:37128633-37128655 CAACATCAGAGAATTCATACTGG + Exonic
1165608483 19:37128801-37128823 CTACATCAGAGAATCCATACTGG + Exonic
1165620508 19:37242795-37242817 CAACATCAGAGAATTCATATTGG + Exonic
1165620521 19:37242963-37242985 CAACATCAGAGAATCCATACCGG + Exonic
1165620545 19:37243215-37243237 CAACATCAGAGAATTCATACTGG + Exonic
1165641234 19:37389004-37389026 GAACATCAAAGAACTCATATTGG + Exonic
1165641271 19:37389424-37389446 CAACATCAGAGAATTCATACCGG + Exonic
1165641291 19:37389676-37389698 CAACATCAAAGAATTCATACTGG + Exonic
1165650554 19:37484829-37484851 CAACATCAGAGAATTCATACTGG + Exonic
1165650578 19:37485081-37485103 CAACATCAGAGAATTCATACTGG + Exonic
1165659602 19:37565184-37565206 CAACATCAAAGAATTCATACCGG - Exonic
1165664170 19:37612142-37612164 CAACATAAAAGAATTCATACTGG + Exonic
1165664242 19:37612982-37613004 GAACATCAGAAAATTCATACGGG + Exonic
1165666563 19:37635156-37635178 CAACATCAAAGTATTCATACTGG - Exonic
1165669967 19:37668475-37668497 CAACATCAAAGAATTCCTACTGG - Exonic
1165669990 19:37668721-37668743 CAACATCAAAATATTCATACTGG - Exonic
1165670040 19:37669476-37669498 CAACATCAAAGAATTCATACTGG - Exonic
1165670057 19:37669811-37669833 CGACATCAAAGAATTCATACTGG - Exonic
1165677400 19:37738673-37738695 CAACATCAGAAAATTCATACTGG - Exonic
1165677420 19:37738925-37738947 CAACATCAGAAAATTCATACTGG - Exonic
1165677439 19:37739177-37739199 CAACATCAGAAAATTCATACTGG - Exonic
1165677448 19:37739261-37739283 CAACATCAGAAAACTCATACTGG - Exonic
1165889528 19:39102323-39102345 CAACAACAAAAAAACTATCTTGG + Intronic
1166019607 19:40014306-40014328 GAACATCAAAGAATTCATACTGG + Exonic
1166019615 19:40014390-40014412 CAACATCAGAAAATTCATACTGG + Exonic
1166019624 19:40014474-40014496 CAACATCAGAAAATTCATACTGG + Exonic
1166019684 19:40015230-40015252 CAACATCACAGAATTCATACTGG + Exonic
1166021586 19:40035789-40035811 CGACATCAGAAGATTCATATGGG - Exonic
1166576701 19:43847523-43847545 CAACATCAGAAAATTCATACTGG + Exonic
1166576718 19:43847691-43847713 CAGCATCAGAAAATCCATACTGG + Exonic
1166576734 19:43847859-43847881 CAACATGAAAGAATTCATACTGG + Exonic
1166576741 19:43847943-43847965 CAACATCAGAAAATCCATACTGG + Exonic
1166576770 19:43848195-43848217 CAACATGAAAGAATCCATACAGG + Exonic
1166576781 19:43848279-43848301 CAACATCAGAAAATTCATACCGG + Exonic
1166578832 19:43873498-43873520 GAACATCAGAAAATTCATGTTGG - Exonic
1166587782 19:43966397-43966419 GAACATCAGAGAATCCATACTGG + Exonic
1166600122 19:44086304-44086326 GAACATCAAAGAATCCATACTGG + Exonic
1166602233 19:44106989-44107011 GAACATCAGAGAATCCATACGGG + Exonic
1166604795 19:44131443-44131465 GAACATCAAAGAATCCATACTGG + Exonic
1166903472 19:46085890-46085912 CAACAACAAAGAAACCATACAGG + Intergenic
1167819648 19:51915430-51915452 TTACATCAAAAAATCCATACCGG - Intronic
1167865426 19:52322328-52322350 CGACATCAGAAAATTCATACTGG + Exonic
1167870555 19:52366207-52366229 CGACATCAAAGAATTCATACTGG + Exonic
1167872528 19:52384265-52384287 CAACATCAAAGAATTCATACTGG + Exonic
1167872542 19:52384517-52384539 CGACATCAGAAAATTCATAGTGG + Exonic
1167872557 19:52384685-52384707 AGACATCAAAGAATCCATACTGG + Exonic
1167876279 19:52415624-52415646 CAACATCAAAGAATTCATACTGG + Exonic
1167876282 19:52415708-52415730 CAACATCAAAGAATTCATACTGG + Exonic
1167876286 19:52415792-52415814 CGACATCAAAAAATTCATACTGG + Exonic
1167878857 19:52438151-52438173 CAACATCAACGAATCCATACTGG + Exonic
1167878862 19:52438235-52438257 CAACATCAGAAAATTCATACTGG + Exonic
1167882702 19:52474819-52474841 CAACATCGAAGAATTCATACTGG - Intronic
1167882713 19:52475070-52475092 CAACATCACAGAATTCATATAGG - Intronic
1167887250 19:52511123-52511145 AAACATCAGATAATCCATTTAGG + Exonic
1167896081 19:52582753-52582775 AAACATCAGATAATCCATTTAGG + Exonic
1167899991 19:52613375-52613397 CAACATCACAGAATCCATACTGG - Exonic
1167900017 19:52613711-52613733 CAACATCAGAGAATCCACACTGG - Exonic
1167900037 19:52613963-52613985 CAACATCAAAGAATTCATACCGG - Exonic
1167900326 19:52616824-52616846 CAAGAGCAAAAACTCCATCTCGG + Intronic
1167935761 19:52905846-52905868 AGACATCAAAGAATCCATACTGG - Intergenic
1167961580 19:53109074-53109096 CTACATCAGAAAACTCATATTGG - Exonic
1167965472 19:53141806-53141828 CAACATCAGAAAATTCACACTGG - Exonic
1167977110 19:53237195-53237217 CAGCATAAGAAAATCCATACTGG - Exonic
1167977133 19:53237531-53237553 CAACATAAGAGAATCCATACTGG - Exonic
1167990028 19:53351369-53351391 AAACATCAGATAATCCATTTAGG + Exonic
1168006291 19:53490926-53490948 AAACATCAAATAATCCATTTAGG + Exonic
1168016399 19:53577002-53577024 CAACATCAGAAAATCCATACTGG + Exonic
1168016408 19:53577086-53577108 CAACATCAAAAAATTCATACTGG + Exonic
1168033773 19:53702702-53702724 CAACATCAAAAAACCAGTGTTGG + Intergenic
1168442014 19:56377094-56377116 CAGCATCAAAGAATCCACACGGG + Intronic
1168446716 19:56424099-56424121 CAACATCAGAGAATTCATACTGG + Exonic
1168448220 19:56441595-56441617 GAACATCAAAGAATTCATACTGG - Exonic
1168457482 19:56524902-56524924 CAGCATCAAAGAATTCATACTGG + Exonic
1168457543 19:56525661-56525683 CAACATCAGAAAACTCATACAGG + Exonic
1168457550 19:56525745-56525767 CAACATCAAAGAATTCATACTGG + Exonic
1168460715 19:56554769-56554791 CAGCATCAGAAAACCCATACAGG + Exonic
1168463089 19:56578005-56578027 CAACATCAGAAAATACACACTGG + Exonic
1168528942 19:57111327-57111349 CAACACCAGGAAATCCATAGTGG - Intergenic
1168531717 19:57135177-57135199 CAACATAAAAAAATCCATACTGG - Exonic
1168557732 19:57357343-57357365 CAACACCAAAAAATCCACACTGG + Exonic
1168574055 19:57493467-57493489 CAGCATCACAAAATCCACACTGG + Exonic
1168574077 19:57493719-57493741 CAACATCAAAAAGTTCACACTGG + Exonic
1168574095 19:57493887-57493909 CAACATCGAAAAGTTCACATTGG + Exonic
1168589480 19:57620780-57620802 CAGCATCAGAGAATCCATACTGG + Exonic
1168653373 19:58108520-58108542 GTACATCAAAAAATCCACACAGG - Intronic
925499452 2:4487234-4487256 TTACATCCAAAAATCCAAATAGG + Intergenic
926345772 2:11943655-11943677 AAACATGAAAAAATATATATAGG - Intergenic
926769807 2:16360193-16360215 CAACATTAGAAAAGCCCTATGGG - Intergenic
926791556 2:16576616-16576638 CAACATCAATAATGCAATATTGG - Intronic
926975240 2:18509459-18509481 AAAAATCAAAAAATAAATATTGG - Intergenic
928969420 2:37012256-37012278 CAAGATCAAGAAATACATTTAGG + Intronic
929703753 2:44188903-44188925 CAACAACAAAAAACCCAAATTGG - Intronic
929724059 2:44405408-44405430 CAACACCTAAAAATACATCTTGG - Intronic
930445950 2:51472452-51472474 CAACAACAAAAAATCAAAAGTGG - Intergenic
930513066 2:52370769-52370791 AAATATCAGAAAATCCATTTGGG + Intergenic
930843001 2:55868642-55868664 ATACATCAAAAAATCAATGTGGG - Intronic
931085590 2:58826779-58826801 CAACATAATAAAAGCCATATAGG - Intergenic
931096868 2:58950372-58950394 CAACATCAAGAAACACATAAGGG - Intergenic
931151630 2:59580674-59580696 AAACAATAAAAAATCCACATTGG + Intergenic
931353622 2:61514772-61514794 ATACACCAAAACATCCATATGGG + Intronic
932031777 2:68195074-68195096 CAACATCAAGAAATTAACATTGG - Intronic
932311616 2:70746998-70747020 AAAAAAAAAAAAATCCATATTGG - Intronic
932395156 2:71439774-71439796 CCACAACAAAAGATCCAGATAGG - Intergenic
933348753 2:81126004-81126026 CAACATAATAAAAGCCATATAGG - Intergenic
934184354 2:89658439-89658461 GGACATCAAAACAGCCATATGGG - Intergenic
935001864 2:99026097-99026119 CAACAACACAAAAACCAAATTGG - Intronic
936060444 2:109292163-109292185 AAACATTTAAAAATACATATTGG - Intronic
936291910 2:111232453-111232475 CAAAACCAGGAAATCCATATCGG - Intergenic
937151827 2:119691530-119691552 CAACATCAATAAAACCGTACTGG - Intergenic
938061339 2:128257176-128257198 CAACAACAACAAAACAATATAGG + Intronic
938654319 2:133415156-133415178 CAACATGAATAAGTCCATTTCGG - Intronic
939512856 2:143127898-143127920 CCGCATAAAAAAATCCATCTTGG - Intronic
941851243 2:170183860-170183882 GAACATTAAAAAATTCAAATGGG - Intronic
942729520 2:179048764-179048786 CAACACCAGAAAATCCACCTCGG + Intronic
942846817 2:180436699-180436721 CAACCTGAGAAAATTCATATAGG - Intergenic
945051845 2:205831335-205831357 AAACACCAACAAAACCATATAGG - Intergenic
945070498 2:205984056-205984078 TAACAGCAAAAAAACCACATGGG + Intergenic
945844256 2:214925214-214925236 CAACACAATAAAAGCCATATAGG - Intergenic
945992739 2:216410098-216410120 CAACAAAAAAAAATGCATTTGGG - Intergenic
946456086 2:219827333-219827355 AAACAGCAAGAAATCCACATGGG + Intergenic
946755767 2:222945951-222945973 CAGCATCAAAACATTCATATGGG - Intergenic
947606712 2:231490844-231490866 CAACAACAAAAAAGCCAGATAGG + Intergenic
947933462 2:233983588-233983610 CAACATTGGAAAATCCACATTGG + Intronic
1168937847 20:1682516-1682538 CAACATAATAAATGCCATATGGG + Intergenic
1171772466 20:29334295-29334317 CAACATACAAAAATCAATAAAGG + Intergenic
1172138026 20:32701021-32701043 CAACAGGCAAAACTCCATATCGG - Intergenic
1172283452 20:33724322-33724344 AAACTTAAAAAAATCAATATTGG + Intergenic
1173830164 20:46078529-46078551 CAAAATCAATTAATCCATTTGGG + Intronic
1173889223 20:46491873-46491895 CAACATAAAAAAATTCATACTGG + Intergenic
1173889265 20:46492437-46492459 CAACATAAAAAAATTCATACTGG + Intergenic
1175020648 20:55845123-55845145 CAACCTCTAAAAATTCATTTGGG - Intergenic
1175512797 20:59545026-59545048 GAACACAAAAAAATCCAAATAGG - Intergenic
1177654259 21:23997564-23997586 CAACAACAACAAACCCATAAAGG - Intergenic
1177818603 21:26005108-26005130 CCACATAAAAAAATGAATATAGG + Intronic
1181512572 22:23395408-23395430 CAACACCAAAAATTCTATCTGGG + Intergenic
1181566922 22:23744482-23744504 CAACACCAAAAGATCCACACCGG - Exonic
1183373167 22:37447133-37447155 CATCATTAAAAAATCTAAATTGG - Intergenic
1183517550 22:38275811-38275833 CAACAACAAAAAAGCCAAAAAGG - Intergenic
1184910562 22:47530954-47530976 CAACAACAAAAAACCCATTTGGG + Intergenic
949292109 3:2479155-2479177 AAATATCAAAAAACCTATATAGG + Intronic
949713788 3:6904017-6904039 CAACATTAAAAAATCAATAATGG - Intronic
949803646 3:7931103-7931125 CAACTTCAAAAAATCTACCTGGG + Intergenic
951005315 3:17609148-17609170 TAATTTCAAAAAATCCATCTTGG - Intronic
951102582 3:18706317-18706339 CAACATAATAAAAGCCATATAGG + Intergenic
951164557 3:19469407-19469429 CAACAACAAAAAAAACATACTGG - Intronic
951539650 3:23770152-23770174 CAAGATCATAAAATACATTTAGG + Intergenic
952251474 3:31660119-31660141 GAACAACAAAAAACCCATAAGGG + Exonic
953170283 3:40500947-40500969 CAGCACCAGAAAATCCACATAGG + Intergenic
953440794 3:42915202-42915224 CGACATCAAAGAATCCATACTGG + Exonic
953633736 3:44643801-44643823 GTACATCAAAGAATCCATACTGG + Exonic
953642419 3:44721415-44721437 CAACATCAAAGAATTCACACTGG + Exonic
954739160 3:52733328-52733350 CAACATCAAAGAATTCATCCTGG + Intronic
956577868 3:70775215-70775237 CAACATAAGAAAATCAAGATTGG + Intergenic
956712071 3:72047823-72047845 CAACAACAAAAAACCCAGAAAGG - Intergenic
958879347 3:99651941-99651963 CAACATCAAGAAATAATTATGGG + Intronic
959487758 3:106947704-106947726 CAACAGCAAAAAAAAAATATTGG + Intergenic
959872547 3:111345012-111345034 GCAGATCAAAAAATCCTTATAGG - Intronic
959941207 3:112083679-112083701 CAACATCAAAAATCTTATATTGG + Intergenic
959977549 3:112478798-112478820 AAACATGAAAAAATACATAGGGG - Intronic
960112049 3:113854733-113854755 CAACATGAAAAAAACCTTTTTGG + Intronic
960728315 3:120694462-120694484 CATCATCAAATAATTCATAGAGG + Intronic
961192407 3:124972979-124973001 CAACAACAAAAAAACCAACTAGG - Intronic
961835183 3:129652134-129652156 CAACATAAAAAATTTCAAATAGG + Intronic
962664708 3:137642398-137642420 CAGAATTAAAAAATCCATCTGGG + Intergenic
962915368 3:139897307-139897329 TAACATCAAAAAATTCAGAGCGG - Intergenic
963708053 3:148713285-148713307 CACCATCCATCAATCCATATTGG + Intronic
963990728 3:151650385-151650407 CAACCTGCTAAAATCCATATTGG - Intergenic
964323064 3:155517974-155517996 ATACATCAAAAAATCCTCATTGG + Intronic
964583299 3:158265218-158265240 CAACATTAAAAAATACATTTTGG + Intronic
964743922 3:159994105-159994127 CAGCCTCAAAACAACCATATGGG + Intronic
966108844 3:176371944-176371966 CAACATAATAAAAGCCATATAGG + Intergenic
966555262 3:181251740-181251762 CCACATCAATATATCCATCTAGG + Intergenic
966977107 3:185094375-185094397 CAACAATAAAAAATACAAATAGG - Intronic
967459890 3:189733516-189733538 CAACATCCAAAGATCCAAACGGG - Intronic
967526239 3:190496699-190496721 CAACAACAAAAAATAAATAAAGG + Intergenic
968398911 4:270778-270800 GAACATAAGAAAATTCATATGGG - Exonic
968409333 4:373587-373609 GAACATAAAAAAATTCATACTGG + Exonic
968409451 4:375350-375372 CAACATCAGAAAATTTATATTGG + Intronic
968416544 4:441035-441057 CAACATCAGAGAATTTATATTGG - Intronic
970764223 4:19527637-19527659 CAAGAGAAAAAAATCCACATTGG + Intergenic
971104486 4:23508087-23508109 CAACATCCAAAACTCCTTCTAGG - Intergenic
971656705 4:29355828-29355850 TAAAATAAAAAAATACATATTGG - Intergenic
972009738 4:34162537-34162559 CAACATAATAAAAGCCATATAGG + Intergenic
972605689 4:40611425-40611447 CAACAACAAAAAACCCACATAGG + Intronic
973155457 4:46946073-46946095 CAACAACAAAAAATTTCTATAGG + Intronic
973795549 4:54422366-54422388 CAACCTCATAAAATTCATACAGG + Intergenic
973853882 4:54991014-54991036 CAACATAATAAAGACCATATAGG + Intergenic
974188597 4:58473644-58473666 CAACATTAAAACATACATTTAGG + Intergenic
975287989 4:72642700-72642722 CCACATCAAAACTTCCAAATAGG - Intergenic
975454058 4:74568375-74568397 CAACATAATAAAGGCCATATAGG + Intergenic
975538019 4:75472381-75472403 CAACATCAAAAAATTTCTTTTGG - Intergenic
976008304 4:80457226-80457248 CCACAACAAAAAAATCATATGGG + Intronic
976164022 4:82234374-82234396 CACCATCAAAAATTCCATTGTGG - Intergenic
976724443 4:88202072-88202094 CAAGATCACAAAATGAATATCGG + Intronic
977318743 4:95484054-95484076 AAATATTAAAAAAACCATATTGG + Intronic
977451809 4:97208323-97208345 AAACATTAAAATATCTATATAGG - Intronic
977637032 4:99311302-99311324 CAACAGAAAAAAGTCTATATTGG + Intronic
978082581 4:104612315-104612337 CAACATAATAAAAGCCATATGGG - Intergenic
978292889 4:107166882-107166904 CAACTTCAAACAATGCATATTGG - Intronic
978676178 4:111319502-111319524 GAACATCTAAAATTACATATGGG - Intergenic
978766557 4:112411215-112411237 CAACAACAACAAAACTATATAGG - Intronic
979210009 4:118089008-118089030 CAATATCACAAATTCCAGATAGG - Intronic
979279915 4:118854718-118854740 GTACATCAAAAAATGCATAATGG + Intronic
980553465 4:134371190-134371212 CAACAACAAAAACTACCTATTGG - Intergenic
980595988 4:134954887-134954909 CTACATCAAAAAGTCCAAAAGGG - Intergenic
981174413 4:141664396-141664418 CAACAACAAAAAAACCCTCTGGG + Intronic
981454324 4:144936103-144936125 CAGCATCAAAAAATATATTTAGG - Intergenic
981793671 4:148569738-148569760 CAACAACAAAAAGTTCATCTAGG + Intergenic
982130065 4:152221044-152221066 CAACATCAAGAAATGCATGATGG + Intergenic
982346652 4:154367482-154367504 CAACACCAAAAAAGCAGTATGGG - Intronic
982793314 4:159617108-159617130 CCTCATAAAAAAATCCCTATCGG - Intergenic
983799726 4:171911842-171911864 AAACAGCAAAATATCCAAATTGG - Intronic
983982651 4:174017762-174017784 AAACAGCAAAGAATCCAAATTGG + Intergenic
984304569 4:177971766-177971788 CAAGATCAAAAATAGCATATTGG - Intronic
984959693 4:185084238-185084260 CAAAAACAAAAAATCTATATTGG + Intergenic
986172331 5:5324971-5324993 CAACATCACAACATCCAACTGGG + Intergenic
986523830 5:8650729-8650751 CAATATAAAAAAATACATCTAGG - Intergenic
987355496 5:17060146-17060168 AAATATCAAAAAATATATATTGG + Intergenic
987499367 5:18687441-18687463 CAATATCAAAAAATGAATACAGG - Intergenic
987599467 5:20047282-20047304 GAACATCAATAAATCCTTAAGGG + Intronic
987700937 5:21397380-21397402 CAAAATCAGAAAATTTATATTGG - Intergenic
988052364 5:26047442-26047464 CAAAATCAAAAAAGACAAATTGG + Intergenic
988060675 5:26164237-26164259 CAACAGCAAAAATTCCATCTAGG - Intergenic
988129546 5:27085200-27085222 GAAACTCAAAAAATCCTTATGGG + Intronic
988153238 5:27415055-27415077 CAACAGCAAAAAGTCCAAAGAGG - Intergenic
989194280 5:38700636-38700658 CAACATCAAAGACTAAATATAGG + Intergenic
989490922 5:42052204-42052226 CAACATCAAAAAAAGGTTATGGG + Intergenic
990125811 5:52516707-52516729 AAACATAAAAACATCCAAATTGG + Intergenic
990187188 5:53221597-53221619 CTTCATCAAACATTCCATATGGG - Intergenic
990926246 5:61027847-61027869 TAAAAACAAAAAATACATATGGG - Intronic
992366471 5:76096265-76096287 CAACATCATAAATTTCTTATTGG + Intronic
993443678 5:87986222-87986244 CAACCTGAACAAATCCAAATAGG + Intergenic
993580163 5:89651687-89651709 AAACAACAAAAAATCCAGACTGG + Intergenic
994001458 5:94786070-94786092 CAACAACAAAAAATTTATCTTGG + Intronic
994098149 5:95866091-95866113 CAACAACAAAAACTAAATATAGG - Intergenic
994362573 5:98870011-98870033 CAACATCAGAAACTCAATAAAGG + Intronic
994491520 5:100451337-100451359 AACCATGAAAAAACCCATATGGG + Intergenic
994950001 5:106449636-106449658 TAAAACGAAAAAATCCATATAGG + Intergenic
995326576 5:110896013-110896035 CAATAACCAAAAATCCATTTTGG - Intergenic
995878604 5:116818876-116818898 CAACAACAAAAAAACCTCATAGG - Intergenic
996238623 5:121167121-121167143 CAACAACAAAAAAGGTATATGGG + Intergenic
996410948 5:123158299-123158321 CTACATAAAAAAATCAAAATTGG - Intronic
996719133 5:126612956-126612978 CAATATCCAAAAATTCACATTGG + Intronic
997679618 5:135740677-135740699 CAGCCTCAAAAAAGCCATCTAGG + Intergenic
998126796 5:139629362-139629384 CAACAACAAAAAATCCCTCAGGG + Intergenic
998661460 5:144243468-144243490 CAACATAAACAAATACACATGGG - Intronic
998913317 5:146985571-146985593 CAACACCATAAAGGCCATATAGG + Intronic
999479386 5:151932670-151932692 CAAAATTAAAAAATCAATATTGG + Intergenic
999558372 5:152770901-152770923 AATCATCAAATAATCCATATAGG - Intergenic
1000219121 5:159194980-159195002 CAACAACAAAAAATCCATAGGGG - Intronic
1000457322 5:161466811-161466833 CTACAGAAAAAAATGCATATTGG - Intronic
1000908435 5:166992329-166992351 CAACAACAAAAAATACACAGTGG - Intergenic
1001344440 5:170878546-170878568 CAACTTAAAAAAATCTAGATAGG + Intronic
1002366078 5:178712409-178712431 CAACATCAGAGAATGCATACTGG - Exonic
1002366135 5:178713081-178713103 CAACATCAAATAACGCATACTGG - Exonic
1002387893 5:178883227-178883249 CAACATCAAAGAACTCATACAGG + Exonic
1002387953 5:178883899-178883921 CAACATCAGAGAATGCATACTGG + Exonic
1002393223 5:178932508-178932530 GAACATCAAAGAATTCATACTGG + Exonic
1002397022 5:178965689-178965711 CAACATCAGAGAATTCATACTGG + Exonic
1002406106 5:179033197-179033219 CAACATCAAAGAATTCACACTGG + Exonic
1003335194 6:5164665-5164687 CAGTATATAAAAATCCATATTGG + Intronic
1004909066 6:20265612-20265634 CAACATCTAAAAGTGGATATAGG - Intergenic
1005593912 6:27359332-27359354 CAACATCAAAGAATGTATACAGG - Intergenic
1005593918 6:27359416-27359438 CTACATCAGAGAATCCATACTGG - Intergenic
1005598341 6:27400914-27400936 CTACATCAGAGAATCCATACTGG + Exonic
1005603563 6:27452234-27452256 CAGCATCAAAAAACTCATACTGG - Exonic
1005603580 6:27452402-27452424 CAACATCAAAAAATTCATACTGG - Exonic
1005603586 6:27452486-27452508 GAACATCAGAAAATTCATACGGG - Exonic
1005603603 6:27452654-27452676 CAACATCAAAGAATTCATACTGG - Exonic
1005677206 6:28166991-28167013 AAACATCAGAGAATCCATACTGG + Intergenic
1005679143 6:28188311-28188333 CAACATCTTAAAATCCACACTGG + Intergenic
1005683847 6:28232804-28232826 CGACATCAAAGAATTCATACTGG + Exonic
1005684930 6:28245138-28245160 CAACATCAGAGAAGCCATGTAGG - Exonic
1005684937 6:28245222-28245244 GAACATCAGAAAATCCACACTGG - Exonic
1005684967 6:28245471-28245493 GAACATCACAAAATTCATACTGG - Exonic
1005688271 6:28276554-28276576 AGACATCAGAAAATCCATCTTGG + Exonic
1005693077 6:28326179-28326201 AAACATCAGAAAATCCACACTGG - Exonic
1005697660 6:28366157-28366179 GAACATCAAAAAATCCACACTGG + Exonic
1005697669 6:28366241-28366263 CAACATCAGAGAAGCCATGTAGG + Exonic
1005954361 6:30653408-30653430 CAACAACAAAAGATCTATGTTGG - Intronic
1006561334 6:34915381-34915403 CAACAACAAAAAACCTACATAGG - Intronic
1008015001 6:46508632-46508654 CAACAACAAAAAAACCACACAGG + Intergenic
1008380375 6:50834351-50834373 CAACATCAATTCATCCATCTGGG + Intronic
1008614215 6:53210525-53210547 CAAAAACAAAAAAACCACATTGG - Intergenic
1009351958 6:62691502-62691524 CAACATTTAAAAATCTTTATAGG + Intergenic
1009505160 6:64468622-64468644 GAGGATCAAAAAATACATATTGG - Intronic
1010424145 6:75707656-75707678 CAACAACAAAAAAGCACTATGGG - Intronic
1010773611 6:79860756-79860778 AACCATAAAAAAATCCAAATAGG + Intergenic
1011246907 6:85329137-85329159 CAACATCCCATAATCCATGTAGG + Intergenic
1012235414 6:96808571-96808593 CAGCATCAGAAAATCCTTTTGGG - Intronic
1012303100 6:97614374-97614396 CAACATAATAAAAGCCTTATAGG - Intergenic
1012314956 6:97774579-97774601 CAACAACAAAAAATCCTTAGGGG + Intergenic
1013856012 6:114572793-114572815 CAACAACAAAAAATCCCTTCTGG - Intergenic
1014303780 6:119715267-119715289 CACAATAAAAAAATCCATGTGGG + Intergenic
1014360995 6:120473477-120473499 CAACATGAATAAATCCAAAAAGG - Intergenic
1014774213 6:125490127-125490149 GAAAATCAAAAATTCAATATGGG + Intergenic
1015020552 6:128468653-128468675 CAACACCAAAACCTCCATGTTGG + Intronic
1015184525 6:130399402-130399424 TAAAATCAAAAAGTCCAAATTGG - Intronic
1015480822 6:133706560-133706582 CAAAACAAAAAAATCCATAAAGG - Intergenic
1015863946 6:137708961-137708983 CACCATCAAAACATCTAAATGGG + Intergenic
1016130140 6:140457868-140457890 AAATATCAAACACTCCATATAGG + Intergenic
1016591485 6:145750054-145750076 AAACATCAGAATATCCATGTTGG - Intergenic
1016865903 6:148765989-148766011 CAAAATAATAAAAGCCATATAGG - Intronic
1019965370 7:4494423-4494445 CAACATGAAAACCTGCATATTGG + Intergenic
1020003764 7:4770780-4770802 CAAGAACAAAAACTCAATATTGG - Exonic
1020285268 7:6674374-6674396 AAACATCAGAAAACACATATAGG + Intergenic
1020337999 7:7078560-7078582 CAGCATCAAAAAATTCACACAGG - Intergenic
1021477788 7:21082218-21082240 CAACCTCATAAATTCCTTATGGG - Intergenic
1023232237 7:38046293-38046315 CAACATAATAAAGTCCAAATAGG - Intergenic
1023451686 7:40292942-40292964 CGTCATGAAAAAAACCATATTGG + Intronic
1024110859 7:46145172-46145194 CAACATCAGAAACTTCATAATGG + Intergenic
1024594977 7:50925009-50925031 AGCCATCAACAAATCCATATTGG - Intergenic
1025148482 7:56525696-56525718 CAACATCAGAAAATTAATACTGG - Intergenic
1025159243 7:56639273-56639295 CAACATAAAATAATTCATGTTGG - Intergenic
1025793043 7:64710276-64710298 CAACACCAGAAAATTTATATTGG + Exonic
1025822273 7:64977829-64977851 AAACATAAGAAAATTCATATTGG - Exonic
1025863446 7:65356277-65356299 CAACATCAGAGAATCAATACCGG + Intergenic
1027890696 7:83969790-83969812 CAAAATCAAAAATTCCAAATAGG + Intronic
1027988024 7:85320143-85320165 AAACCTCAAAACATCCTTATGGG - Intergenic
1028645359 7:93089545-93089567 CAACATGATTAAGTCCATATAGG - Intergenic
1028792249 7:94866338-94866360 TAACATCATACAATCCAAATAGG - Intergenic
1029226068 7:99029246-99029268 CAACAACAAAGAAACCACATAGG + Exonic
1029294774 7:99531425-99531447 CAACATCAAAGAATACACACTGG + Exonic
1029294847 7:99532097-99532119 CAACATCAGAGAATCCATACTGG + Exonic
1029358566 7:100071309-100071331 CAGCATCAAAGAATCCACACCGG - Exonic
1029358640 7:100071813-100071835 CAACATCAGAGAATCCACACTGG - Exonic
1030280318 7:107767864-107767886 CACCATCAAAAAATTCATACCGG + Exonic
1030340340 7:108372368-108372390 CAACAACAAAAAATCTGTACAGG + Intronic
1031275524 7:119716867-119716889 CAACAACAAAAAACCTATTTGGG + Intergenic
1031813495 7:126402630-126402652 CAAAAACAAAAAATGCAGATTGG + Intergenic
1032406790 7:131661933-131661955 CAAGATCTAAAAATCCATCCTGG - Intergenic
1033179744 7:139164354-139164376 CTGCATCAAAAACTCCATAAAGG - Intronic
1033956525 7:146856103-146856125 CAACTTGAAATAATTCATATTGG + Intronic
1034326625 7:150240654-150240676 CAACAACAAAAAAGCCTTATTGG + Intergenic
1034402676 7:150875875-150875897 CAAAACCAGAAAATCCACATAGG - Intergenic
1034486856 7:151371195-151371217 CAACAACAAAAAACCCAAAATGG + Intronic
1034766583 7:153728613-153728635 CAACAACAAAAAAGCCTTATTGG - Intergenic
1037017939 8:13931816-13931838 CAAAATTAAAAAATCCACACAGG - Intergenic
1037601465 8:20399089-20399111 CAACATTATAAAGGCCATATGGG - Intergenic
1038001457 8:23395275-23395297 CAACAACAAAAAAACCATTAAGG + Intronic
1040690396 8:49930014-49930036 CAAAACCAAAAAAGCCTTATAGG + Intronic
1040858088 8:51970732-51970754 CAAGATAAAAAACTACATATTGG - Intergenic
1040986348 8:53297985-53298007 CAAAAACAAAAAAACCCTATTGG + Intergenic
1041832875 8:62176730-62176752 AAACATGAAAAAAACCATCTTGG + Intergenic
1043182390 8:77102494-77102516 CAACAACAAAAAAACCTAATTGG - Intergenic
1043387859 8:79766059-79766081 CAACAACAAAAAATACATCAAGG + Intronic
1043506835 8:80910848-80910870 CAACAACAAAAGATCCTTAAAGG - Intergenic
1044359762 8:91268992-91269014 AAACATCAAAAAGTCAAAATGGG - Intronic
1049608372 8:143540558-143540580 AAACATTAAAAAACCCAAATTGG - Intronic
1049852712 8:144841990-144842012 CAGCATCAAAGAATCCACACTGG + Exonic
1049852851 8:144843142-144843164 CAGCATCAAAAAATTCACATGGG + Exonic
1049865317 8:144931753-144931775 CAACATCAAAGAATCCATTCTGG - Exonic
1049871073 8:144976960-144976982 CAACATCAGAGAATACATAATGG - Intergenic
1049871127 8:144977716-144977738 CAACATCTAAAAATTCATACAGG - Intergenic
1049874309 8:145005840-145005862 TAACACCAAAGAATCCACATTGG - Intergenic
1050207903 9:3217066-3217088 CAACATAAAAATGCCCATATTGG + Intergenic
1050212256 9:3273870-3273892 AAAAAAAAAAAAATCCATATAGG + Intronic
1050284538 9:4087677-4087699 CATCATCATAAAATTCATATCGG + Intronic
1050960027 9:11718532-11718554 CAACATTAAAAAATACTCATAGG - Intergenic
1051259373 9:15247510-15247532 CAACATCAGCAATTCCCTATAGG - Intronic
1051443080 9:17108249-17108271 AAACCACAAAAAATACATATAGG - Intergenic
1052208485 9:25871909-25871931 CAACAACAAAAAATAGGTATTGG - Intergenic
1052482366 9:29047476-29047498 CAACATAATAAAAGCCATATAGG + Intergenic
1053077682 9:35148595-35148617 CAACATAAAAGAATTCATAGTGG - Intergenic
1053606174 9:39662035-39662057 CAACATATAAAAAGCCCTATAGG + Intergenic
1054247368 9:62680381-62680403 CAACATATAAAAAGCCCTATAGG - Intergenic
1054561487 9:66714908-66714930 CAACATATAAAAAGCCCTATAGG - Intergenic
1055082114 9:72277692-72277714 CAACAACAACAAAACCTTATAGG + Intergenic
1055236632 9:74130500-74130522 CTAGATCTATAAATCCATATAGG + Intergenic
1058145666 9:101408261-101408283 CAACATCAAAGGGTCCATACTGG + Exonic
1058145712 9:101408765-101408787 CAACACCAAAAAATTCACACTGG + Exonic
1058145745 9:101409185-101409207 CAACATCAAAGAATCCACACTGG + Exonic
1058312303 9:103519074-103519096 CAAAAACAAACAATCCATACTGG + Intergenic
1058673716 9:107382267-107382289 CATCATCAAAATATCAATAATGG - Intergenic
1059186831 9:112281658-112281680 CTTCATCAATAAAGCCATATGGG + Intronic
1059263042 9:112997562-112997584 CAACATCAAAGAATTCATACTGG - Intergenic
1059263067 9:112997814-112997836 CAACATCATAGAATTCATACTGG - Intergenic
1059263086 9:112997982-112998004 CAGCATCAAAGAGTCCATACTGG - Intergenic
1059263090 9:112998066-112998088 CAACATCAAAGAATACATACTGG - Intergenic
1059263097 9:112998150-112998172 CAGCATCAGAAAACACATATTGG - Intergenic
1059299713 9:113302565-113302587 CAACAACAAAAAATCCCAAAAGG - Intronic
1059916416 9:119107204-119107226 CAACAACAAAAAAACAAAATGGG - Intergenic
1062727818 9:138086765-138086787 CAACAACAAAAAACCCACATTGG + Intronic
1186103112 X:6177692-6177714 CAACATTAAAAAATGGAAATAGG + Intronic
1186213577 X:7275637-7275659 CAACAACAAAAAACAAATATAGG + Intronic
1186292261 X:8113165-8113187 CATCTTCAAAAAATAAATATGGG - Intergenic
1186600167 X:11028319-11028341 AAAAATCAAAAAATATATATTGG - Intergenic
1188108751 X:26172766-26172788 CAACAGAAAAAAAACCTTATGGG + Intergenic
1188732103 X:33662047-33662069 CAACACAATAAAGTCCATATAGG + Intergenic
1189504735 X:41600840-41600862 CAACCACAAAACATCAATATTGG + Intronic
1189977157 X:46473469-46473491 AAACATCAGATAATTCATATGGG + Exonic
1190092168 X:47448718-47448740 ACACATCAAAAAATTCATACCGG - Exonic
1191023905 X:55893015-55893037 CAACACCAAAATTTCAATATTGG - Intergenic
1191793504 X:64996611-64996633 CAAAATTAAAATATTCATATAGG + Intronic
1191829949 X:65406507-65406529 CAACATAATAAAAGCTATATAGG + Intronic
1192019684 X:67374140-67374162 AAACATAAAAGAATTCATATTGG + Intergenic
1192537997 X:71945081-71945103 CAATTTCAAAAAATACATCTTGG - Intergenic
1192958301 X:76096692-76096714 CAACACCATAAAAGCCAAATAGG - Intergenic
1193266070 X:79471285-79471307 CAACCTCAAAAAATCAATATAGG - Intergenic
1193783774 X:85734619-85734641 CAAATTCAAAAAATCAAAATGGG - Intergenic
1193807715 X:86014240-86014262 CAACATTAAAAAAACTATATCGG + Intronic
1194148888 X:90298934-90298956 TAACAGCCACAAATCCATATAGG + Intergenic
1194199437 X:90936683-90936705 CAACAACAAAAAACCTATAGAGG - Intergenic
1194817849 X:98466539-98466561 TAACATAAAAATATCCCTATTGG - Intergenic
1195637332 X:107132986-107133008 CAACCCCAAAAACTCCATAAAGG - Intronic
1196052541 X:111320932-111320954 CAAAAACAAAAAAACCATATAGG - Intronic
1196102198 X:111858372-111858394 CAACAACAAAAACTACAAATTGG - Intronic
1196304097 X:114080567-114080589 GAATATCACAAAATCAATATTGG + Intergenic
1196392447 X:115222642-115222664 CAACATCAAAAACTAAAAATAGG + Intronic
1196991421 X:121333213-121333235 CAACATCTAAAAAGGCAAATGGG - Intergenic
1197022179 X:121705092-121705114 CTGCAGCAATAAATCCATATTGG - Intergenic
1197076088 X:122354474-122354496 CAACATAATAAAAGCTATATAGG + Intergenic
1197079113 X:122390648-122390670 TAGCATCAAAAAATACATAGAGG - Intergenic
1197850001 X:130848006-130848028 CAACAACAAAAAAACCCTAGAGG - Intronic
1199047970 X:143199583-143199605 CAACATAATAAAAGCCATATAGG - Intergenic
1199337602 X:146638663-146638685 TAACATCAATAATTCCATATTGG + Intergenic
1199812297 X:151361903-151361925 CAACATAGAAATATCCATACTGG + Intergenic
1200328233 X:155264826-155264848 AAACAGCAATAAATGCATATAGG - Intergenic
1200495256 Y:3875668-3875690 TAACAGCCACAAATCCATATAGG + Intergenic
1202015056 Y:20396301-20396323 CAACATCAAAAAATCCATATAGG + Intergenic