ID: 1202016766

View in Genome Browser
Species Human (GRCh38)
Location Y:20416206-20416228
Sequence GCCTGTCAACCATGTCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202016764_1202016766 16 Left 1202016764 Y:20416167-20416189 CCTTTAATCTGTTCAAATGGTCT No data
Right 1202016766 Y:20416206-20416228 GCCTGTCAACCATGTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202016766 Original CRISPR GCCTGTCAACCATGTCATTT TGG Intergenic