ID: 1202018393

View in Genome Browser
Species Human (GRCh38)
Location Y:20435539-20435561
Sequence TCCAGGGCAGTAGGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202018384_1202018393 30 Left 1202018384 Y:20435486-20435508 CCACGGTGCTCTCCTGTTGATAA No data
Right 1202018393 Y:20435539-20435561 TCCAGGGCAGTAGGCTCCCAGGG No data
1202018385_1202018393 18 Left 1202018385 Y:20435498-20435520 CCTGTTGATAAGTGAATCAACCT No data
Right 1202018393 Y:20435539-20435561 TCCAGGGCAGTAGGCTCCCAGGG No data
1202018387_1202018393 -2 Left 1202018387 Y:20435518-20435540 CCTGACTTTATTGCAGTGGCCTC No data
Right 1202018393 Y:20435539-20435561 TCCAGGGCAGTAGGCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202018393 Original CRISPR TCCAGGGCAGTAGGCTCCCA GGG Intergenic