ID: 1202018393 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:20435539-20435561 |
Sequence | TCCAGGGCAGTAGGCTCCCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202018384_1202018393 | 30 | Left | 1202018384 | Y:20435486-20435508 | CCACGGTGCTCTCCTGTTGATAA | No data | ||
Right | 1202018393 | Y:20435539-20435561 | TCCAGGGCAGTAGGCTCCCAGGG | No data | ||||
1202018385_1202018393 | 18 | Left | 1202018385 | Y:20435498-20435520 | CCTGTTGATAAGTGAATCAACCT | No data | ||
Right | 1202018393 | Y:20435539-20435561 | TCCAGGGCAGTAGGCTCCCAGGG | No data | ||||
1202018387_1202018393 | -2 | Left | 1202018387 | Y:20435518-20435540 | CCTGACTTTATTGCAGTGGCCTC | No data | ||
Right | 1202018393 | Y:20435539-20435561 | TCCAGGGCAGTAGGCTCCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202018393 | Original CRISPR | TCCAGGGCAGTAGGCTCCCA GGG | Intergenic | ||