ID: 1202023309

View in Genome Browser
Species Human (GRCh38)
Location Y:20491488-20491510
Sequence ACCCATATCCTATCCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202023309_1202023321 30 Left 1202023309 Y:20491488-20491510 CCACAGCAGGATAGGATATGGGT No data
Right 1202023321 Y:20491541-20491563 CTCCTGAACACATCCTGGGCTGG No data
1202023309_1202023318 25 Left 1202023309 Y:20491488-20491510 CCACAGCAGGATAGGATATGGGT No data
Right 1202023318 Y:20491536-20491558 CCCAGCTCCTGAACACATCCTGG No data
1202023309_1202023320 26 Left 1202023309 Y:20491488-20491510 CCACAGCAGGATAGGATATGGGT No data
Right 1202023320 Y:20491537-20491559 CCAGCTCCTGAACACATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202023309 Original CRISPR ACCCATATCCTATCCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr