ID: 1202025976

View in Genome Browser
Species Human (GRCh38)
Location Y:20524417-20524439
Sequence TAGGTTCGACAACATCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202025976_1202025978 -6 Left 1202025976 Y:20524417-20524439 CCTTGGTGATGTTGTCGAACCTA No data
Right 1202025978 Y:20524434-20524456 AACCTATCTATAGAAGGAACAGG No data
1202025976_1202025980 -3 Left 1202025976 Y:20524417-20524439 CCTTGGTGATGTTGTCGAACCTA No data
Right 1202025980 Y:20524437-20524459 CTATCTATAGAAGGAACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202025976 Original CRISPR TAGGTTCGACAACATCACCA AGG (reversed) Intergenic
No off target data available for this crispr