ID: 1202026807 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:20532781-20532803 |
| Sequence | CATTATTAGCTTGATGTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202026807_1202026810 | 23 | Left | 1202026807 | Y:20532781-20532803 | CCATCCACATCAAGCTAATAATG | No data | ||
| Right | 1202026810 | Y:20532827-20532849 | AAATTACTTTAAAGTTCATATGG | 0: 88 1: 10148 2: 5774 3: 3659 4: 3450 |
||||
| 1202026807_1202026809 | -4 | Left | 1202026807 | Y:20532781-20532803 | CCATCCACATCAAGCTAATAATG | No data | ||
| Right | 1202026809 | Y:20532800-20532822 | AATGACTTTCTTCACAGAATTGG | 0: 9526 1: 4614 2: 1479 3: 527 4: 533 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202026807 | Original CRISPR | CATTATTAGCTTGATGTGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||