ID: 1202026807

View in Genome Browser
Species Human (GRCh38)
Location Y:20532781-20532803
Sequence CATTATTAGCTTGATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202026807_1202026810 23 Left 1202026807 Y:20532781-20532803 CCATCCACATCAAGCTAATAATG No data
Right 1202026810 Y:20532827-20532849 AAATTACTTTAAAGTTCATATGG 0: 88
1: 10148
2: 5774
3: 3659
4: 3450
1202026807_1202026809 -4 Left 1202026807 Y:20532781-20532803 CCATCCACATCAAGCTAATAATG No data
Right 1202026809 Y:20532800-20532822 AATGACTTTCTTCACAGAATTGG 0: 9526
1: 4614
2: 1479
3: 527
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202026807 Original CRISPR CATTATTAGCTTGATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr