ID: 1202027942

View in Genome Browser
Species Human (GRCh38)
Location Y:20544004-20544026
Sequence GCAGCAGTCCTGCTACATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202027942_1202027944 -3 Left 1202027942 Y:20544004-20544026 CCGTCATGTAGCAGGACTGCTGC No data
Right 1202027944 Y:20544024-20544046 TGCACTCTAAAGGAAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202027942 Original CRISPR GCAGCAGTCCTGCTACATGA CGG (reversed) Intergenic
No off target data available for this crispr