ID: 1202028601

View in Genome Browser
Species Human (GRCh38)
Location Y:20551023-20551045
Sequence CAACAGAGGGAGACCGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202028601_1202028611 27 Left 1202028601 Y:20551023-20551045 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1202028611 Y:20551073-20551095 GGACTGTATTGCCGTGGTCTCGG No data
1202028601_1202028607 2 Left 1202028601 Y:20551023-20551045 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1202028607 Y:20551048-20551070 GAGGCTGGACTGTGTTGCCGAGG No data
1202028601_1202028610 21 Left 1202028601 Y:20551023-20551045 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1202028610 Y:20551067-20551089 GAGGCTGGACTGTATTGCCGTGG No data
1202028601_1202028608 6 Left 1202028601 Y:20551023-20551045 CCTTCTTCGGTCTCCCTCTGTTG No data
Right 1202028608 Y:20551052-20551074 CTGGACTGTGTTGCCGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202028601 Original CRISPR CAACAGAGGGAGACCGAAGA AGG (reversed) Intergenic
No off target data available for this crispr