ID: 1202029096

View in Genome Browser
Species Human (GRCh38)
Location Y:20553122-20553144
Sequence GGCCGCAGGAACCTCTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3256
Summary {0: 5, 1: 406, 2: 1694, 3: 781, 4: 370}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202029092_1202029096 0 Left 1202029092 Y:20553099-20553121 CCAGGGACACAAACACAGCCGAA No data
Right 1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG 0: 5
1: 406
2: 1694
3: 781
4: 370
1202029091_1202029096 1 Left 1202029091 Y:20553098-20553120 CCCAGGGACACAAACACAGCCGA No data
Right 1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG 0: 5
1: 406
2: 1694
3: 781
4: 370
1202029089_1202029096 16 Left 1202029089 Y:20553083-20553105 CCCTAATCTCAAGTACCCAGGGA 0: 2042
1: 517
2: 380
3: 30
4: 133
Right 1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG 0: 5
1: 406
2: 1694
3: 781
4: 370
1202029090_1202029096 15 Left 1202029090 Y:20553084-20553106 CCTAATCTCAAGTACCCAGGGAC 0: 2037
1: 514
2: 379
3: 36
4: 110
Right 1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG 0: 5
1: 406
2: 1694
3: 781
4: 370
1202029086_1202029096 21 Left 1202029086 Y:20553078-20553100 CCACTCCCTAATCTCAAGTACCC 0: 2088
1: 498
2: 162
3: 314
4: 1246
Right 1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG 0: 5
1: 406
2: 1694
3: 781
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202029096 Original CRISPR GGCCGCAGGAACCTCTGCCT AGG Intergenic
Too many off-targets to display for this crispr