ID: 1202032182

View in Genome Browser
Species Human (GRCh38)
Location Y:20588652-20588674
Sequence TCTCTTTGATGGTGTCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202032182_1202032185 13 Left 1202032182 Y:20588652-20588674 CCCTCATGACACCATCAAAGAGA 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1202032185 Y:20588688-20588710 TAAAGCCTGAGTATTTTACTTGG 0: 1
1: 0
2: 0
3: 11
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202032182 Original CRISPR TCTCTTTGATGGTGTCATGA GGG (reversed) Intronic
901693829 1:10991758-10991780 TATCTCTGATGGTGTCATCAAGG - Intergenic
902149839 1:14434381-14434403 TCTCTTTGGTAGTTTAATGATGG + Intergenic
904039755 1:27576978-27577000 TCTCTGTGTTCATGTCATGACGG - Intronic
904905173 1:33892078-33892100 TTTTTTTGATGGTGTCTTTAGGG - Intronic
907029715 1:51158432-51158454 CGTCTCTGATGGTGTCATCAAGG - Intergenic
907062778 1:51448052-51448074 TCTCTTAGATGGTGGCACCAAGG + Exonic
911665015 1:100542190-100542212 TCTCTTTGATGCTGGTATGTGGG - Intergenic
913278998 1:117167285-117167307 TCTATTTCTTGGTGTGATGATGG - Intronic
913427513 1:118750359-118750381 TTTCTTTCATGGTGTCATACTGG - Intergenic
916733408 1:167586267-167586289 GGTCTTTGATGATGTCATTAAGG - Intergenic
917677667 1:177335503-177335525 TCTCTGTGATGCTGTCCTCAGGG + Intergenic
918083456 1:181224923-181224945 TCTCCTTGCTGGTCACATGATGG + Intergenic
918556735 1:185810132-185810154 TCTATTTAATAGTGTGATGAAGG - Intronic
923997357 1:239510423-239510445 TCTCTGTGATGGTCACAAGACGG - Intronic
924234994 1:241993204-241993226 CATCTCTGATGGTGTCATCAAGG + Intergenic
1064601608 10:16999248-16999270 TCTCTTTGATGATGTACTAAAGG - Intronic
1068589184 10:58836473-58836495 TTTCTTTGATGTTCTCAAGATGG + Intergenic
1069769614 10:70888918-70888940 TCTCGGTGATGGTCTCACGAGGG - Intergenic
1069862706 10:71481435-71481457 TCTCTTTGGTGGGGCCATGTGGG - Intronic
1070463068 10:76689137-76689159 TGTCTGTGATGTTGTCCTGAGGG + Intergenic
1070493426 10:76998943-76998965 TTTGTTTGATGGAGTGATGACGG + Intronic
1070501332 10:77075464-77075486 TTTGTTTGAAGGTGCCATGAAGG - Intronic
1070658197 10:78285685-78285707 TCACTTTCATGGTGATATGAGGG + Intergenic
1071693140 10:87843887-87843909 TGTCTTTGATGATGTCATCAAGG + Intergenic
1076039564 10:127232668-127232690 CCACTGTGTTGGTGTCATGAAGG - Intronic
1076487137 10:130830417-130830439 TCTCTATGATGCTGTAATGATGG + Intergenic
1077471365 11:2762189-2762211 TCTCCGTGATGGTCTCATGAAGG - Intronic
1078404436 11:11057629-11057651 TCCCTTTGGTGGTTTCATGGTGG - Intergenic
1079290531 11:19184314-19184336 TTCCTTTGATAGTGTCAAGAAGG + Intronic
1079864094 11:25713346-25713368 TCAATTTGATGGTGAAATGATGG + Intergenic
1080279329 11:30538742-30538764 TCTCTTTGATGGCATCATGGTGG - Intronic
1081111492 11:39139284-39139306 TCTCTTTTATTCTGTCAGGAAGG - Intergenic
1081133808 11:39412856-39412878 TCTGTTTGATGCTATGATGATGG + Intergenic
1081165908 11:39808874-39808896 TTCCTTTGGTAGTGTCATGATGG - Intergenic
1081307950 11:41536518-41536540 TGTCTTGGCTGGTGTCTTGAAGG - Intergenic
1083933004 11:65856206-65856228 TGTCTCTGATGGTGTCATCAAGG - Exonic
1085368033 11:75970954-75970976 TCTGTTTGATGCTGTAATGATGG - Intronic
1086285999 11:85252291-85252313 TCTCTTACATGATGTAATGATGG - Intronic
1087355674 11:97090961-97090983 TCTCTATCATGGTGACAAGATGG + Intergenic
1089916423 11:122161326-122161348 TCATTTTGATTGAGTCATGATGG - Intergenic
1093138283 12:15477803-15477825 TCCCTCTGATGGTGCCATGGAGG - Intronic
1094296826 12:28915766-28915788 TCTGTTTGGTGGTGTCATTCAGG - Intergenic
1096585679 12:52618191-52618213 TCTTGTTGATGGTGACCTGATGG + Exonic
1097704877 12:62857868-62857890 TCTTTGTGAGGGTTTCATGAGGG + Intronic
1103128977 12:118450336-118450358 TCCCTTTTATGGAGTCTTGAAGG + Intergenic
1103617057 12:122160892-122160914 TCTCTCTGATGGTTTTATAAGGG + Intergenic
1105545492 13:21347894-21347916 TCTCTTTGGCGGCCTCATGAGGG - Intergenic
1106676067 13:31959713-31959735 TTTCTGTGATGATCTCATGAAGG - Intergenic
1112592239 13:100774406-100774428 TCTCTCTGATGGTGCTAGGAGGG - Intergenic
1113282700 13:108807567-108807589 TCTCCTTGATTGAGTCTTGATGG + Intronic
1116000628 14:39238955-39238977 TATCTTTGATTGTATCATTATGG + Intronic
1118268650 14:64320492-64320514 TCTGTATGATGATGTAATGATGG + Intronic
1120265890 14:82250611-82250633 ACTCTTTGAAGGTGGCAGGATGG - Intergenic
1125982094 15:44011733-44011755 CTTCTTTGATGGCGTCATCAGGG - Intronic
1127701554 15:61506200-61506222 TCTCTTTCATGGAGTCATTCTGG - Intergenic
1128249501 15:66154542-66154564 TCTTTATGATGGTGTGTTGAAGG - Intronic
1131837008 15:96400872-96400894 TTTCTTTGATACTGTAATGATGG + Intergenic
1134098093 16:11432686-11432708 TCTCTCCAATGGTGTCATGTAGG - Intronic
1135067246 16:19320803-19320825 TTTCTGAGATGGGGTCATGAGGG - Intronic
1137561262 16:49503708-49503730 TTGCGCTGATGGTGTCATGAGGG - Intronic
1137780838 16:51096587-51096609 TCTCTTGGAAGGTGACATGTGGG - Intergenic
1137877523 16:52011627-52011649 TCAATTTGATCCTGTCATGATGG + Intronic
1137948837 16:52762419-52762441 TATCTTTGATGATGTTATGGGGG + Intergenic
1138517839 16:57547176-57547198 TTTTTTTGTTGTTGTCATGAAGG + Intronic
1138740176 16:59299108-59299130 TCTCTTTGATGATTTCAAGAAGG - Intergenic
1139242227 16:65404816-65404838 TCTTTCTGATGGTGTTAAGATGG + Intergenic
1139337519 16:66243500-66243522 TCTTCTTGTTGGTGTCAGGAAGG + Intergenic
1140308185 16:73823382-73823404 TGTCATTGATGCTGTCTTGAGGG - Intergenic
1140656138 16:77142128-77142150 TCTCCTTGATGGTGTTGTCAAGG - Intergenic
1141274027 16:82568678-82568700 TCTCTATGATGCTGTCTTGCTGG + Intergenic
1143422150 17:6802066-6802088 TCTCTTTTTTGGTGTGATAAAGG - Intronic
1144291378 17:13830021-13830043 TCTCCTTGCTGGATTCATGAAGG + Intergenic
1144302141 17:13931465-13931487 GCTGTTTGATGATGTCATCAAGG - Intergenic
1144614697 17:16758000-16758022 TCTCTTTGATGTTTTCCTCAAGG + Intronic
1144898008 17:18557674-18557696 TCTCTTTGATGTTTTCCTCAAGG - Intergenic
1145097668 17:20045275-20045297 TCTTTTTGATGGTTGAATGATGG + Intronic
1145134360 17:20388040-20388062 TCTCTTTGATGTTTTCCTCAAGG + Intergenic
1145940711 17:28742079-28742101 TCTCCTGGATTGTGTCATCATGG + Exonic
1146308987 17:31752636-31752658 TCTCTCTGATGGTGTTTGGATGG - Intergenic
1147652699 17:42071449-42071471 TGTCTTTGGGGGTGTCAGGAGGG - Intergenic
1149635550 17:58166157-58166179 TCTCTTTCATGGTGTTGTCAAGG - Intergenic
1150813138 17:68372580-68372602 TCCCTTTGCTGTTCTCATGATGG - Intronic
1151176248 17:72290581-72290603 GCACTTTGATGGTGTCATTTTGG + Intergenic
1154039758 18:10842688-10842710 TCTGTTTAATGTTGCCATGAAGG - Intronic
1156927748 18:42603165-42603187 TCTGTCTCATGGTGTCATGGTGG + Intergenic
1157554975 18:48607528-48607550 TCTTTTTGACAGTTTCATGATGG - Intronic
1158288253 18:55909285-55909307 TATCTTTGATGGTATCAGCAAGG + Intergenic
1163298077 19:16425233-16425255 TCTCTTGGAGGGTGGGATGAGGG + Exonic
1165341878 19:35218392-35218414 TCTCTGTGTTGGTGATATGAAGG - Intergenic
1166380460 19:42352832-42352854 TGGCTTTGATGGTGTCATGGTGG + Intronic
1166452605 19:42914834-42914856 TCTCCTTGATCCTCTCATGACGG + Intronic
1167406074 19:49309688-49309710 TTTCTTTGCTGGTGTCTTGTTGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG + Intergenic
927739829 2:25558969-25558991 TCTTGTTGATGGTGTTATGGAGG - Intronic
928599973 2:32894958-32894980 TCTCTGAGACTGTGTCATGAGGG + Intergenic
928878856 2:36073749-36073771 TCTCTGGGATGGTGTAATCAGGG - Intergenic
929092228 2:38230073-38230095 TCTCTATGATACTGTAATGATGG + Intergenic
929236663 2:39612390-39612412 TCTCATTGATGGTGACATCTAGG + Intergenic
932936407 2:76108301-76108323 TGTCTTTGATGGGCTCATCATGG - Intergenic
935177595 2:100663442-100663464 TGTGTATGATGGTGCCATGATGG + Intergenic
935455780 2:103266211-103266233 TATCTGTGATGGTGACATGGCGG + Intergenic
935924965 2:108057815-108057837 TGTCTTTGATTGTGTGATGTAGG - Intergenic
937336872 2:121067680-121067702 TCTCTCTGCAGGTGGCATGATGG - Intergenic
941758835 2:169218576-169218598 TCTCTTTCATGGGGCCATGGTGG - Intronic
942693058 2:178607887-178607909 TTTCTTTGACGGTGTACTGACGG + Exonic
944411854 2:199453353-199453375 TCTTTTCAATGGTGTAATGATGG - Intronic
946203809 2:218089234-218089256 TCTCTCTGATGGGGGGATGAAGG - Exonic
947158450 2:227187380-227187402 TGACTTTGATGGTGTGATCATGG + Intronic
948935314 2:241160148-241160170 TCACACTGATGCTGTCATGAGGG - Intronic
1169265715 20:4166291-4166313 TCTCTCTGATACTGTCATCAAGG + Intronic
1169471080 20:5886119-5886141 CCTCTGTGATGTGGTCATGAAGG - Intergenic
1170371074 20:15648780-15648802 TCTCTCTAATGGTCTCATTAAGG - Intronic
1170964526 20:21054266-21054288 TTTATTTGATGTTGTCTTGAGGG - Intergenic
1171327318 20:24305982-24306004 TCTGTATGATGGTATCATGGTGG - Intergenic
1171946317 20:31381364-31381386 TCTATTTGAAGATGTCATAATGG - Intronic
1173142657 20:40497958-40497980 ACTCTGAGATGGTGACATGAAGG + Intergenic
1173921886 20:46752268-46752290 TCTCTTTGCTGGTAGCATGAAGG - Intergenic
1174904485 20:54536239-54536261 TCTCTGAGATGGTGACATCATGG + Intronic
1174990641 20:55505509-55505531 TCTCTTTGTTGGCTTGATGAAGG - Intergenic
1175040489 20:56045399-56045421 TCAGTTTGATCTTGTCATGAGGG + Intergenic
1175573770 20:60044570-60044592 TTTTTTTGATGGAGTCATCAGGG + Intergenic
1175611421 20:60354399-60354421 TGTCTCTGATGGTGACAGGATGG - Intergenic
1177520351 21:22213757-22213779 TCTTAGTGATGGTGGCATGAGGG + Intergenic
1177694383 21:24553400-24553422 TCTCTTTGATGATTTCAGGTTGG + Intergenic
1178135263 21:29619743-29619765 TTTCTTTAATGGAGGCATGATGG + Intronic
1179108402 21:38424107-38424129 TCAGTTTGATGAGGTCATGAGGG + Intronic
1181994251 22:26862443-26862465 TCTGTTTGCTGGTGTCATTTAGG + Intergenic
1184755691 22:46514649-46514671 TCTCTTTGATGCTGGGAGGAGGG - Intronic
949680787 3:6512221-6512243 TCTCTTTGATGCTGTAACAATGG + Intergenic
949799297 3:7885345-7885367 TTTCTTTGTCTGTGTCATGATGG - Intergenic
951158593 3:19386894-19386916 TTTCTGTGATTCTGTCATGAGGG + Intronic
951403730 3:22268203-22268225 TCACTCTGATGCTGTCATTAGGG + Intronic
951572181 3:24076223-24076245 TCTTTTTGATGGAGGCATTAAGG + Intergenic
952128494 3:30331810-30331832 TCTGAGTGATGGTGACATGAGGG + Intergenic
952877885 3:37962453-37962475 TCTCTTAGATCGTACCATGAGGG + Intronic
957733030 3:84167318-84167340 TCTGTTTGATGGTGTCACACAGG + Intergenic
959141159 3:102487775-102487797 TCCCTATGCTGTTGTCATGATGG + Intergenic
961434106 3:126904695-126904717 TCTCTCTGTTAGTGCCATGATGG - Intronic
963150378 3:142039799-142039821 CCTCTGTGATGGAGGCATGATGG + Intronic
963207342 3:142650424-142650446 TCTCTTTGTTGGAGGCATGATGG + Intronic
963380980 3:144530029-144530051 TATCTTTAATGGTTTCAGGAGGG - Intergenic
963886800 3:150592178-150592200 TCTGTATGATGCTGTAATGATGG + Intronic
964066200 3:152582979-152583001 CCTCTTTGATGGTGTGCTGCTGG - Intergenic
964155721 3:153582800-153582822 TCTGCTTGATGCTGTCATGATGG - Intergenic
964464440 3:156974978-156975000 TATCATTGGTGGTGGCATGAAGG - Intronic
964507282 3:157413173-157413195 TCTCTCTGATGATTTCATGTTGG - Intronic
967896689 3:194401204-194401226 CCTTTTTTATGGTGTCTTGAAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968989095 4:3896698-3896720 TCTCTTGGAAGGATTCATGAGGG - Intergenic
969208854 4:5670979-5671001 TGCCGCTGATGGTGTCATGATGG - Intronic
969332118 4:6480395-6480417 TGTGTTTGATGATGTCACGATGG + Intronic
969367062 4:6702186-6702208 TCACTTTGATGGTGGCATTGTGG - Intergenic
974303363 4:60098646-60098668 ACTCTTGGATGGTTTCAGGATGG + Intergenic
974503515 4:62736732-62736754 TGTCTTAAATGGTTTCATGATGG + Intergenic
975059688 4:69982194-69982216 TTTCTTTGATAGTGTCATTTTGG + Intergenic
975247251 4:72133653-72133675 TCTATTTGTTTGTGTCATCATGG + Intronic
975691659 4:76970781-76970803 TCTCTTTGATGCTGTATTCAGGG + Intronic
976871790 4:89803144-89803166 TCTCTATGATACTGTCATGGTGG - Intronic
978932060 4:114326289-114326311 TCTCATTGGTGCTGTCACGAAGG + Intergenic
981028141 4:140096752-140096774 TTTGTGTGATGGTGTCATTAGGG - Intronic
981413544 4:144461055-144461077 TCTCTTTGAATGTGTAATTATGG - Intergenic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
985143179 4:186863893-186863915 TCTCTTTGATGGGGGAATGGAGG - Intergenic
987743010 5:21934691-21934713 TCTCTTTGATGGTTTCTGGTGGG + Intronic
988665218 5:33319861-33319883 TCTCTTGGCTGGGGTCAAGAAGG - Intergenic
989573959 5:42971885-42971907 TTTTTTTGATGGTGTCTTGCTGG + Intergenic
990183101 5:53184573-53184595 TCTCTTTGCTGGCATCAGGAAGG - Intergenic
991700723 5:69313833-69313855 TGTCTCTGATGGTGTCATCAAGG - Intronic
992610472 5:78504251-78504273 CCTCTTTGAGGGTGTTCTGAAGG + Intronic
992681514 5:79158018-79158040 TCTCTTTGATGGTTCATTGAAGG + Intronic
993250086 5:85510732-85510754 TCTTTTTGATGTAGTCATGTAGG + Intergenic
993629562 5:90269189-90269211 TCTCTCTGATGTTTTCATCACGG + Intergenic
996437083 5:123446334-123446356 TCTCTATGATGCTGTAATGGTGG + Intergenic
997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG + Intronic
999441757 5:151606665-151606687 TGTTTTTGATGGTGCCTTGAAGG + Intergenic
1000274860 5:159725248-159725270 TGTTTCTGATGGTGTGATGAAGG - Intergenic
1001653726 5:173332350-173332372 TCTCTTTGATGGGGGGATTAAGG - Intergenic
1001886173 5:175292430-175292452 TTTATTTGTTAGTGTCATGAAGG + Intergenic
1003406138 6:5828591-5828613 TCTTTTTGGTGGCCTCATGAGGG + Intergenic
1007300247 6:40862571-40862593 TCTTTTTTGTTGTGTCATGAGGG + Intergenic
1008560702 6:52721979-52722001 TATTTGTGAAGGTGTCATGATGG + Intergenic
1008695346 6:54029451-54029473 TCTCATTGATGGTGTCTTCTAGG - Intronic
1009355955 6:62744912-62744934 TCTCTTTGATTTTGTAATGTTGG - Intergenic
1012043924 6:94244887-94244909 TCTCTATGATACTGTAATGATGG - Intergenic
1012894229 6:104930586-104930608 TCTCTTTGAGAGTGTGATGAAGG + Intergenic
1012977824 6:105799000-105799022 TCCTTTAGATGGTGTCAAGATGG - Intergenic
1014203306 6:118627714-118627736 TCCCTTTTCTGGAGTCATGAGGG - Intronic
1016062786 6:139647550-139647572 TCTATTTTATGGTTTCTTGATGG - Intergenic
1019616614 7:1965815-1965837 GCACTTTGCTGGTGTCATGGAGG - Intronic
1021250386 7:18318058-18318080 TCTCTTTGATGCTGTTTTGATGG - Intronic
1021692554 7:23244726-23244748 TCTCTTTGATGGTGCAGGGAAGG + Intronic
1025907685 7:65800642-65800664 GCTCTTTGATGTAGACATGAAGG + Intergenic
1026657254 7:72267508-72267530 TATATGTGATGGTGACATGACGG + Intronic
1027390906 7:77702615-77702637 TCTCTTTGTGGGTGGAATGATGG + Intronic
1030228638 7:107181121-107181143 CTTCTTTCATGGAGTCATGAAGG - Intronic
1032773354 7:135083258-135083280 TCACTTTGATGGTAGTATGAAGG - Intronic
1032806623 7:135361382-135361404 TCTCTTTGTGAGTGCCATGATGG - Intergenic
1033107748 7:138544959-138544981 TCCCATTTGTGGTGTCATGATGG - Intronic
1035304317 7:157921378-157921400 TCTGTTTGATGCTATGATGATGG + Intronic
1037373908 8:18208514-18208536 TCTTTTTGATGCTATTATGATGG - Intronic
1037659306 8:20913309-20913331 TCTCTTTAACAGAGTCATGATGG + Intergenic
1039307459 8:36278203-36278225 TATCTTTGATGGTGTAGTAAGGG + Intergenic
1040075180 8:43222148-43222170 TTTCTTTGCTGATTTCATGAAGG + Intergenic
1041874572 8:62673376-62673398 TCTCTTTTCTGTTTTCATGATGG - Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045514615 8:102847395-102847417 TTTCTTTGATGCTCTCTTGAAGG + Intronic
1046260447 8:111760110-111760132 TTTCATTGTTGGTGTCATAAGGG - Intergenic
1046274149 8:111935121-111935143 TCTCTTTGTTGGTTTTATAATGG - Intergenic
1048430748 8:134368337-134368359 TCTCTCTGGTGGTGTCTTGGAGG - Intergenic
1050064385 9:1743526-1743548 TCCCTTTTATGGGGTCATTAAGG + Intergenic
1050100555 9:2114671-2114693 TCTGTTTCATGGGCTCATGAAGG + Intronic
1050820405 9:9872051-9872073 TGTCTGTGGTGGGGTCATGATGG + Intronic
1050879546 9:10681665-10681687 TCTCTTTGCTGGTGTTAAAAGGG - Intergenic
1052871693 9:33513764-33513786 TTTCTTTGCTGATTTCATGAGGG + Intergenic
1055394713 9:75861806-75861828 TAGCTTTGATGGTGTCTAGAGGG - Intergenic
1057021864 9:91705408-91705430 TTTGTTTGATGGTGTCTTGTAGG + Intronic
1057336590 9:94160430-94160452 TGTCTTTGAGGGTGTCTGGAAGG - Intergenic
1058924445 9:109648573-109648595 TATTTTTGATAGTGTCATCAGGG + Intronic
1059778363 9:117500106-117500128 TCTCTGTGATGATATCATCAAGG - Intergenic
1059925516 9:119205417-119205439 TTTCTTTGAAGGTCCCATGATGG + Intronic
1185968367 X:4633319-4633341 TCTCTTTCTTCATGTCATGAGGG + Intergenic
1187250177 X:17590883-17590905 TCTCTGAGATGGTGGAATGATGG + Intronic
1192375512 X:70557137-70557159 TCTTTTTGATGCTGTTATAAAGG - Intronic
1192746657 X:73945540-73945562 TTTTTTTGATGGGGTGATGAAGG + Intergenic
1194631482 X:96290883-96290905 TATGTTTGATGGTGTCCTGCAGG - Intergenic
1194905297 X:99568456-99568478 TCTCTTTGCAGATGACATGATGG - Intergenic
1195429598 X:104773712-104773734 TGTCTTTCATGGTCACATGATGG - Intronic
1195472723 X:105250284-105250306 TCTGTATGATGCTGTAATGATGG + Intronic
1195487490 X:105425843-105425865 TCTTTTTGTTGGTGTTAGGATGG - Intronic
1195502908 X:105623674-105623696 TGTCTTTGATGGCCACATGAAGG + Intronic
1195581674 X:106511022-106511044 TATCATTGATGGTGTGTTGAGGG - Intergenic
1196344125 X:114631813-114631835 AGTATTTGAAGGTGTCATGATGG - Intronic
1197850610 X:130855123-130855145 TCTATTTGCAGGTGACATGAGGG + Intronic
1200811404 Y:7489115-7489137 TCTCTTTGATGGGGTCACCCAGG + Intergenic
1202032182 Y:20588652-20588674 TCTCTTTGATGGTGTCATGAGGG - Intronic
1202128741 Y:21591401-21591423 TCTCTGTGGTTGTGTCCTGATGG - Intergenic