ID: 1202036525

View in Genome Browser
Species Human (GRCh38)
Location Y:20642047-20642069
Sequence TCTCCTTGATGGTGAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202036525_1202036528 -9 Left 1202036525 Y:20642047-20642069 CCTCCTGTTCACCATCAAGGAGA No data
Right 1202036528 Y:20642061-20642083 TCAAGGAGATGCTTCTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202036525 Original CRISPR TCTCCTTGATGGTGAACAGG AGG (reversed) Intergenic
No off target data available for this crispr