ID: 1202036919

View in Genome Browser
Species Human (GRCh38)
Location Y:20645588-20645610
Sequence CATAGCCACAACTAACAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202036919_1202036924 -8 Left 1202036919 Y:20645588-20645610 CCGACTTGTTAGTTGTGGCTATG No data
Right 1202036924 Y:20645603-20645625 TGGCTATGGTGAAGAAGGGGAGG No data
1202036919_1202036925 -2 Left 1202036919 Y:20645588-20645610 CCGACTTGTTAGTTGTGGCTATG No data
Right 1202036925 Y:20645609-20645631 TGGTGAAGAAGGGGAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202036919 Original CRISPR CATAGCCACAACTAACAAGT CGG (reversed) Intergenic
No off target data available for this crispr