ID: 1202037305

View in Genome Browser
Species Human (GRCh38)
Location Y:20647990-20648012
Sequence AAAGGCCTGTTGAACACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202037299_1202037305 5 Left 1202037299 Y:20647962-20647984 CCAAGTACATGGGGCATTATACA 0: 2
1: 5
2: 5
3: 20
4: 88
Right 1202037305 Y:20647990-20648012 AAAGGCCTGTTGAACACTGGGGG No data
1202037295_1202037305 18 Left 1202037295 Y:20647949-20647971 CCTTTTTAACTCTCCAAGTACAT No data
Right 1202037305 Y:20647990-20648012 AAAGGCCTGTTGAACACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202037305 Original CRISPR AAAGGCCTGTTGAACACTGG GGG Intergenic
No off target data available for this crispr