ID: 1202039090

View in Genome Browser
Species Human (GRCh38)
Location Y:20664221-20664243
Sequence GCTTACATAGTGATGTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202039090_1202039092 1 Left 1202039090 Y:20664221-20664243 CCAGACTACATCACTATGTAAGC No data
Right 1202039092 Y:20664245-20664267 CCCTGCTATTGTGCAGAGCTTGG No data
1202039090_1202039095 24 Left 1202039090 Y:20664221-20664243 CCAGACTACATCACTATGTAAGC No data
Right 1202039095 Y:20664268-20664290 TCAAAGTGTAATATTTCATAGGG No data
1202039090_1202039094 23 Left 1202039090 Y:20664221-20664243 CCAGACTACATCACTATGTAAGC No data
Right 1202039094 Y:20664267-20664289 GTCAAAGTGTAATATTTCATAGG No data
1202039090_1202039097 26 Left 1202039090 Y:20664221-20664243 CCAGACTACATCACTATGTAAGC No data
Right 1202039097 Y:20664270-20664292 AAAGTGTAATATTTCATAGGGGG No data
1202039090_1202039098 30 Left 1202039090 Y:20664221-20664243 CCAGACTACATCACTATGTAAGC No data
Right 1202039098 Y:20664274-20664296 TGTAATATTTCATAGGGGGTTGG No data
1202039090_1202039096 25 Left 1202039090 Y:20664221-20664243 CCAGACTACATCACTATGTAAGC No data
Right 1202039096 Y:20664269-20664291 CAAAGTGTAATATTTCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202039090 Original CRISPR GCTTACATAGTGATGTAGTC TGG (reversed) Intergenic
No off target data available for this crispr