ID: 1202040261

View in Genome Browser
Species Human (GRCh38)
Location Y:20675189-20675211
Sequence CTCAGTGATGTCTCCTAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202040261_1202040269 20 Left 1202040261 Y:20675189-20675211 CCTAACTAGGAGACATCACTGAG No data
Right 1202040269 Y:20675232-20675254 AAACAGGGAGATGATCCTCTGGG No data
1202040261_1202040268 19 Left 1202040261 Y:20675189-20675211 CCTAACTAGGAGACATCACTGAG No data
Right 1202040268 Y:20675231-20675253 CAAACAGGGAGATGATCCTCTGG No data
1202040261_1202040266 5 Left 1202040261 Y:20675189-20675211 CCTAACTAGGAGACATCACTGAG No data
Right 1202040266 Y:20675217-20675239 GCTGACAGACACCTCAAACAGGG No data
1202040261_1202040265 4 Left 1202040261 Y:20675189-20675211 CCTAACTAGGAGACATCACTGAG No data
Right 1202040265 Y:20675216-20675238 GGCTGACAGACACCTCAAACAGG 0: 16
1: 140
2: 507
3: 843
4: 986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202040261 Original CRISPR CTCAGTGATGTCTCCTAGTT AGG (reversed) Intergenic
No off target data available for this crispr